ID: 1064010166

View in Genome Browser
Species Human (GRCh38)
Location 10:11729356-11729378
Sequence CATTTCTATCGAGCTCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064010164_1064010166 5 Left 1064010164 10:11729328-11729350 CCAACCTGGGTTAGGTTACAATA No data
Right 1064010166 10:11729356-11729378 CATTTCTATCGAGCTCGCCCTGG No data
1064010165_1064010166 1 Left 1064010165 10:11729332-11729354 CCTGGGTTAGGTTACAATAGCAA No data
Right 1064010166 10:11729356-11729378 CATTTCTATCGAGCTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064010166 Original CRISPR CATTTCTATCGAGCTCGCCC TGG Intergenic
No off target data available for this crispr