ID: 1064016076

View in Genome Browser
Species Human (GRCh38)
Location 10:11773291-11773313
Sequence CCTGAACAGCAGACATTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064016076_1064016080 -6 Left 1064016076 10:11773291-11773313 CCATCCAATGTCTGCTGTTCAGG No data
Right 1064016080 10:11773308-11773330 TTCAGGGAACCCAAACTAATTGG No data
1064016076_1064016082 3 Left 1064016076 10:11773291-11773313 CCATCCAATGTCTGCTGTTCAGG No data
Right 1064016082 10:11773317-11773339 CCCAAACTAATTGGAGACGCTGG No data
1064016076_1064016084 14 Left 1064016076 10:11773291-11773313 CCATCCAATGTCTGCTGTTCAGG No data
Right 1064016084 10:11773328-11773350 TGGAGACGCTGGTTCGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064016076 Original CRISPR CCTGAACAGCAGACATTGGA TGG (reversed) Intergenic
No off target data available for this crispr