ID: 1064020086

View in Genome Browser
Species Human (GRCh38)
Location 10:11801977-11801999
Sequence CTGGAGACTCAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064020077_1064020086 17 Left 1064020077 10:11801937-11801959 CCATGGGTACACAAAGGCCTGTG No data
Right 1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG No data
1064020081_1064020086 0 Left 1064020081 10:11801954-11801976 CCTGTGGAGTAGGACAGTGGACA No data
Right 1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064020086 Original CRISPR CTGGAGACTCAGAAGGAGGG AGG Intergenic
No off target data available for this crispr