ID: 1064024800

View in Genome Browser
Species Human (GRCh38)
Location 10:11839264-11839286
Sequence AATTTCTACTAGCATTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2164
Summary {0: 1, 1: 0, 2: 5, 3: 149, 4: 2009}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064024800_1064024802 13 Left 1064024800 10:11839264-11839286 CCATAAAAATGCTAGTAGAAATT 0: 1
1: 0
2: 5
3: 149
4: 2009
Right 1064024802 10:11839300-11839322 CTATATTCTTAGAGTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064024800 Original CRISPR AATTTCTACTAGCATTTTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr