ID: 1064025539

View in Genome Browser
Species Human (GRCh38)
Location 10:11845824-11845846
Sequence CACTCTCCTGCCTCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3474
Summary {0: 1, 1: 3, 2: 19, 3: 170, 4: 3281}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064025539_1064025545 10 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025545 10:11845857-11845879 AAGCTGGAGAATGGTTCTGGTGG No data
1064025539_1064025548 13 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025548 10:11845860-11845882 CTGGAGAATGGTTCTGGTGGGGG No data
1064025539_1064025547 12 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025547 10:11845859-11845881 GCTGGAGAATGGTTCTGGTGGGG No data
1064025539_1064025542 -6 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025542 10:11845841-11845863 AGAGTGAGGCTAGAGAAAGCTGG No data
1064025539_1064025543 1 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025543 10:11845848-11845870 GGCTAGAGAAAGCTGGAGAATGG No data
1064025539_1064025546 11 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025546 10:11845858-11845880 AGCTGGAGAATGGTTCTGGTGGG No data
1064025539_1064025549 14 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025549 10:11845861-11845883 TGGAGAATGGTTCTGGTGGGGGG No data
1064025539_1064025544 7 Left 1064025539 10:11845824-11845846 CCTGCTCCTGAGGCAGGAGAGTG 0: 1
1: 3
2: 19
3: 170
4: 3281
Right 1064025544 10:11845854-11845876 AGAAAGCTGGAGAATGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064025539 Original CRISPR CACTCTCCTGCCTCAGGAGC AGG (reversed) Intronic
Too many off-targets to display for this crispr