ID: 1064028794

View in Genome Browser
Species Human (GRCh38)
Location 10:11869976-11869998
Sequence CCCCGCGGCGGGGAAGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 328}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064028794_1064028809 2 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028809 10:11870001-11870023 CGCCGGCGAGGGGGCCCCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 166
1064028794_1064028818 23 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028818 10:11870022-11870044 GGGCGGCTCCTCCCCGGAGCGGG 0: 1
1: 0
2: 1
3: 26
4: 284
1064028794_1064028806 -7 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028806 10:11869992-11870014 CGCGGGGGACGCCGGCGAGGGGG 0: 1
1: 0
2: 3
3: 23
4: 265
1064028794_1064028817 22 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028817 10:11870021-11870043 GGGGCGGCTCCTCCCCGGAGCGG 0: 1
1: 0
2: 2
3: 20
4: 339
1064028794_1064028808 1 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028808 10:11870000-11870022 ACGCCGGCGAGGGGGCCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1064028794_1064028802 -10 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028802 10:11869989-11870011 CGCCGCGGGGGACGCCGGCGAGG 0: 1
1: 0
2: 2
3: 25
4: 267
1064028794_1064028812 6 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028812 10:11870005-11870027 GGCGAGGGGGCCCCAGGGGGCGG 0: 1
1: 0
2: 4
3: 62
4: 812
1064028794_1064028819 26 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028819 10:11870025-11870047 CGGCTCCTCCCCGGAGCGGGTGG 0: 1
1: 0
2: 0
3: 31
4: 204
1064028794_1064028805 -8 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028805 10:11869991-11870013 CCGCGGGGGACGCCGGCGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 161
1064028794_1064028807 0 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028807 10:11869999-11870021 GACGCCGGCGAGGGGGCCCCAGG 0: 1
1: 0
2: 3
3: 17
4: 208
1064028794_1064028810 3 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028810 10:11870002-11870024 GCCGGCGAGGGGGCCCCAGGGGG 0: 1
1: 1
2: 3
3: 28
4: 289
1064028794_1064028803 -9 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028803 10:11869990-11870012 GCCGCGGGGGACGCCGGCGAGGG 0: 1
1: 0
2: 0
3: 20
4: 179
1064028794_1064028815 17 Left 1064028794 10:11869976-11869998 CCGGCGCCTTCCCCGCCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 328
Right 1064028815 10:11870016-11870038 CCCAGGGGGCGGCTCCTCCCCGG 0: 1
1: 0
2: 1
3: 43
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064028794 Original CRISPR CCCCGCGGCGGGGAAGGCGC CGG (reversed) Exonic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
900789079 1:4667362-4667384 CCCCACGGAGGGGCAGGGGCAGG - Intronic
901021195 1:6256866-6256888 CCCTAAGGCGGGGAAGGCCCTGG + Intronic
901086120 1:6613464-6613486 CCCCGCGGCCGAGCCGGCGCGGG + Intronic
901663577 1:10814006-10814028 ACCCGTGGCGGGGAGGGCGCTGG - Intergenic
902044205 1:13513210-13513232 CCCGGCCGAGCGGAAGGCGCCGG + Exonic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902585781 1:17438099-17438121 CCCGGCGGCCGGGCCGGCGCAGG - Intronic
903628113 1:24745663-24745685 CCCCGCAGCCGGGAGGGAGCCGG - Intronic
903652993 1:24932422-24932444 CTCCGCGGCTGGCAGGGCGCGGG - Intronic
903738177 1:25543576-25543598 CGCCGCGGCGGAGCTGGCGCTGG + Exonic
903750323 1:25617173-25617195 CTCCGCCGCGGAGAGGGCGCCGG - Intergenic
904003147 1:27349830-27349852 TCCCGCGGCGAGGGAGGGGCAGG - Intronic
904044853 1:27603101-27603123 CCCCGAGCCGGGGGAGCCGCGGG + Intronic
904054251 1:27659839-27659861 CCCCGCGGCGGGCCGGGCACAGG - Intergenic
905151499 1:35931297-35931319 CCCCGAGGCGGGGGCGGCGACGG - Exonic
905648279 1:39639698-39639720 CCCCGAGGCGGGGCCGGGGCGGG - Exonic
906157436 1:43622019-43622041 CCCCACGGCGGGGGTGGCGGAGG - Exonic
907051169 1:51330596-51330618 GCCGGGGGCGGGGAAGGCGGCGG + Intronic
907188998 1:52633276-52633298 CCGCGCGGAGGGGTAGGGGCAGG - Intergenic
911078991 1:93909505-93909527 TCCCGCGGCGGGGCAGGGGCGGG + Intergenic
914702987 1:150150503-150150525 CCCGGGGGCGGGGGAGGTGCGGG - Intronic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
917876796 1:179293657-179293679 CCGCGCGCCCGGGAAGGGGCGGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
921060445 1:211579662-211579684 CTCGGCGGCGGGGGAGGGGCCGG + Intergenic
922200031 1:223393675-223393697 CCCCGCGGCCTCGCAGGCGCGGG + Exonic
922766411 1:228158708-228158730 GGCCGCCGCAGGGAAGGCGCAGG - Exonic
1063369602 10:5512516-5512538 GCCCACGGCGAGGAAGGGGCGGG - Intergenic
1063661198 10:8036022-8036044 CCCGGGGGCGCGGAAGGTGCGGG + Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064274200 10:13891773-13891795 GCCCGCGGCGGGGGCGGCGGCGG - Intronic
1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG + Intronic
1066370405 10:34814823-34814845 GGCGGCGGCGGGGACGGCGCCGG - Intronic
1067028743 10:42866266-42866288 CCCCGGGGCGGGTCAGGCGTAGG + Intergenic
1067071900 10:43138524-43138546 CCCCGCGGCGCAGGAGGCGGTGG + Exonic
1067142278 10:43667701-43667723 CCCCGCAGTGGGGAGGGCCCCGG - Intergenic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1068955218 10:62815137-62815159 CCCGGCCTCGAGGAAGGCGCGGG + Intronic
1069695551 10:70382790-70382812 CCCTGCGGCCGGGAGCGCGCGGG - Intergenic
1069849813 10:71397385-71397407 CCGCGCGGCGGGGAAGTTGGTGG + Intronic
1070032724 10:72692551-72692573 CACCAGGGCGGGGAAGGCACGGG + Intronic
1070660618 10:78303108-78303130 CGCGGCGGCGGGAAAGGCCCTGG + Intergenic
1070800834 10:79243559-79243581 CCCGGCGGCGGCGGCGGCGCGGG - Intronic
1073325570 10:102642667-102642689 CGCCGCCGCGAGGAAGGCGGCGG - Intergenic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1076728048 10:132422371-132422393 CCCCACGGAGGAGAAGGCTCTGG + Intergenic
1076900629 10:133335834-133335856 CTCTGGGGCGGGGAAGGCGTGGG + Intronic
1076998463 11:310754-310776 CCCCGTGGTGGGGGCGGCGCAGG + Intronic
1077000280 11:319005-319027 CCCCGTGGTGGGGGCGGCGCAGG - Intergenic
1077063644 11:628234-628256 GGCCGCGGCGGCGAAGGCGGAGG - Intergenic
1077144056 11:1036985-1037007 CCCAGCAGCGGGGAGGGCCCGGG - Intergenic
1077273476 11:1692626-1692648 CCCCGGGGAGGGGCAGGGGCTGG + Intergenic
1077406809 11:2386414-2386436 CCCCGTGGTGGGAAAGGCACAGG - Intronic
1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG + Intergenic
1077503708 11:2920594-2920616 CCCAGGGACGGGGAAGGAGCAGG + Intronic
1083265760 11:61546203-61546225 CGCCGCGGCGGGGCTGGCGGTGG - Exonic
1083958830 11:66002680-66002702 CCGCGCTGCGGGGAGGGGGCGGG + Intronic
1083970304 11:66070405-66070427 CCCCGCGGCGGCGGCGGCGGGGG - Intronic
1084165298 11:67372611-67372633 CCCCGCGGCGGGGGCGGGGGCGG + Intronic
1084174339 11:67415769-67415791 CCCCGGGGCGGGGCCGGAGCTGG - Intronic
1084265507 11:68003503-68003525 CCCCGCGGCGGGGGTGGGGTTGG - Intronic
1084265618 11:68003874-68003896 CCCCCCGGCGGGGGCGGGGCGGG - Intronic
1084357464 11:68649835-68649857 CCCCGGGGCCGGGAAAGGGCCGG + Intergenic
1084526951 11:69703784-69703806 CCCCGCGTCCGAGAAGGCGAGGG + Exonic
1084546755 11:69818613-69818635 CCCCGCGGGGGAGGCGGCGCCGG - Intronic
1087432288 11:98069575-98069597 CCCCTTGGCGGGGAAGGGGAAGG + Intergenic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1091274734 11:134342554-134342576 CCCCGCGGCAGGGGAAGGGCAGG - Intronic
1091498278 12:991160-991182 CCCCGCGGCGGGGCTGGGGGCGG + Intronic
1091550302 12:1531027-1531049 CCGCGGGGCCGGGAAGGCGGAGG - Intronic
1091718225 12:2794912-2794934 CCCCGCCGCGAGGGAGGGGCTGG - Intergenic
1091732349 12:2890611-2890633 CCGCGCGGCGGGCGAGGCCCAGG + Intronic
1094025801 12:25958830-25958852 GCCCGCGGCGGCGTTGGCGCTGG + Intergenic
1096435910 12:51591104-51591126 GCGCGCGGAGGGGTAGGCGCGGG + Intronic
1096489715 12:52006958-52006980 CCCCTCGGCGGGGCTGGCGGCGG - Exonic
1096983738 12:55743397-55743419 CCCCGCGGCGGCGGCGGCGGCGG + Exonic
1098897833 12:76084022-76084044 CCCCGAGGCGGGGAGGGGGCGGG - Intronic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1100611402 12:96194357-96194379 CGGGGCGGCGGGGGAGGCGCGGG + Intergenic
1100632027 12:96399574-96399596 CCCCTCGGCGGGGGTGGAGCTGG - Intronic
1100831003 12:98516292-98516314 CCCCGCGGGGCTGCAGGCGCCGG + Intronic
1101466765 12:104957864-104957886 GCCCGAGGTGGGGCAGGCGCGGG + Intronic
1101716933 12:107319783-107319805 CCCCGCGGCGGATAAAGAGCGGG + Exonic
1103705112 12:122867232-122867254 CCACGCGGGGGGGCAGGGGCGGG + Exonic
1104506532 12:129337576-129337598 CTCGGGGGAGGGGAAGGCGCCGG - Intronic
1104901159 12:132190193-132190215 CCGCGCGGCGGGAGAGGGGCCGG - Intergenic
1104929262 12:132329495-132329517 GGGGGCGGCGGGGAAGGCGCGGG + Intergenic
1105964527 13:25372322-25372344 GCCCGGGGCGGGGGCGGCGCGGG + Intronic
1106208749 13:27621773-27621795 CCCCGCGTCGGGGCGGGGGCTGG + Exonic
1106447581 13:29850345-29850367 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1106810033 13:33350241-33350263 CACGGGGGCGGGGGAGGCGCCGG - Intronic
1108314080 13:49220977-49220999 CCCGACGGCGGGGACGGCGGTGG - Exonic
1108555189 13:51584640-51584662 CCCCGCGGCGCGGTTGGCGGCGG + Exonic
1118854615 14:69611543-69611565 CCCCGCGGAGGGGAGGGGGCGGG - Intergenic
1119046243 14:71320889-71320911 CCCGGAGGAGGGGAAGGCGGAGG - Intronic
1121103331 14:91264655-91264677 CCCCGTGGCGGGGTGGGCGGCGG - Intergenic
1122137853 14:99645124-99645146 CGCGGCGGCAGGGAAGGGGCGGG - Exonic
1122270925 14:100568188-100568210 CCCCGGGGCGAAGAAGGGGCCGG + Intronic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122552078 14:102555613-102555635 CCCGGCGGCGGGGGAGGCGGCGG + Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122959386 14:105087550-105087572 CCGCCCGGCGGGGCAGGCTCCGG + Intergenic
1123047652 14:105526642-105526664 GCGGGCGGCGGGGTAGGCGCGGG + Exonic
1125689604 15:41585483-41585505 CCCCGCGGCCTGCAGGGCGCCGG - Intergenic
1125834291 15:42736586-42736608 GCCCGCCGCGGGGTAGCCGCGGG - Exonic
1126592706 15:50355451-50355473 CCCCGCTGCCGCGCAGGCGCCGG - Intergenic
1126849910 15:52790497-52790519 CAGCGCCGCAGGGAAGGCGCTGG - Intronic
1128119234 15:65133549-65133571 TCCCGCGGCGGAGGCGGCGCTGG - Exonic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1128309629 15:66622177-66622199 GCCCACGGCCGGGAGGGCGCAGG - Intronic
1129199875 15:73992335-73992357 ACCCGCGGCGGCGCGGGCGCAGG + Exonic
1129274007 15:74433708-74433730 CCGCGCGGCCGGTCAGGCGCGGG - Intronic
1129676015 15:77632737-77632759 CCCCGCGTCGGGAGAGGGGCCGG + Intronic
1131143786 15:89999339-89999361 CCCCGTGCCGGCGAAGGTGCTGG - Intergenic
1131149201 15:90036427-90036449 TCCCTCGGTGGGGAAGACGCTGG - Intronic
1132527689 16:425796-425818 CCCGGCGGCGCGGCGGGCGCAGG - Exonic
1132930320 16:2455692-2455714 CTCCCCGGCGGGGCAGGAGCTGG - Intronic
1133218463 16:4307646-4307668 CCCCGCGTGGGGGTAGGGGCGGG + Intergenic
1133736743 16:8621765-8621787 CCCCGCGGCGGGTAAGTGCCTGG + Exonic
1133784412 16:8963568-8963590 CCCCGCGGCGGCGGCGGCGGCGG - Intronic
1135296535 16:21283931-21283953 CCCCGCAGCGGCGGAGGCGGCGG + Intronic
1135335845 16:21600037-21600059 ACGCCCGGCGGGGAAGGCGCGGG - Intronic
1136556693 16:31011184-31011206 CACCGCGGCGGGAGAGGCCCAGG - Intergenic
1137585942 16:49664172-49664194 CCCGGCGGCAGGGCAGGCGAGGG + Intronic
1137988508 16:53130606-53130628 CCTCGGGGCGGGGAAGGCTTGGG - Intronic
1138105708 16:54286207-54286229 CTCCGCGGCGGCGACGGCGGCGG + Exonic
1138327955 16:56191299-56191321 CCCCGGGACGGGGAGGGCGCGGG - Intergenic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1138478287 16:57284711-57284733 CCCGGCGGCGGGGGCGGAGCCGG - Intergenic
1139534450 16:67562809-67562831 CCCGGCGGCGGCGCTGGCGCCGG - Intronic
1139643594 16:68311089-68311111 TCCCGCGGCGGGTGAGGCGCTGG + Intronic
1141184689 16:81779135-81779157 CTCCATGGCGGGGAGGGCGCGGG + Intronic
1141638615 16:85328803-85328825 CCCCGGGGCGGGGAGGCCCCGGG - Intergenic
1141828990 16:86498999-86499021 CTCGGCGGCCAGGAAGGCGCCGG - Intergenic
1142386814 16:89770551-89770573 CCCCGGAGAGGTGAAGGCGCGGG - Exonic
1142671746 17:1490889-1490911 CCCCGGGCTGGGGAAGCCGCAGG - Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1144835616 17:18155206-18155228 CACCGTGGCGGGGAAGATGCGGG - Exonic
1145750732 17:27353661-27353683 CCCCACGGCGGGGAGGAGGCTGG - Intergenic
1145915424 17:28571236-28571258 CTCCGCGTCGGGGATGGGGCCGG - Intronic
1146132558 17:30291725-30291747 CCCGGCGGCGGGGAAGGCCGGGG - Intronic
1146167435 17:30600839-30600861 CCCGGCGGCGGGGTTGGCGGGGG - Intergenic
1146183100 17:30709532-30709554 CCTCGCGGCGGCGGAGGCTCGGG - Intergenic
1146957226 17:36942726-36942748 CGGAGCGGCGGGGAGGGCGCAGG - Intronic
1147315478 17:39618146-39618168 CCACGCGGCGGGGGCGGGGCGGG + Intergenic
1147317334 17:39627231-39627253 GCCCGCCGAGGGGAGGGCGCGGG - Exonic
1147440240 17:40443379-40443401 CCCCACCTCTGGGAAGGCGCTGG + Intergenic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1149430665 17:56593924-56593946 CCGCGGGGCGCGGGAGGCGCCGG - Exonic
1149430714 17:56594096-56594118 ACCCGAGGCTGGGCAGGCGCAGG - Exonic
1149455608 17:56785765-56785787 CCCTGAGGTGGGGAAGGAGCAGG - Intergenic
1150358374 17:64507047-64507069 CGACGCGGCCGGGAAGGCGACGG - Exonic
1150373508 17:64661884-64661906 CCCGGCGGCGGGGGCGGCGGGGG + Exonic
1151757140 17:76081497-76081519 CCCGGCGGGGGGGAAGGAGGTGG - Intronic
1152210255 17:78999312-78999334 CCCTGCTGCCGGGAAGGCCCCGG - Intronic
1152354144 17:79798465-79798487 ACCCGTGGCGGGGGCGGCGCTGG + Intronic
1152526104 17:80889095-80889117 CCCAGCTGCAGGGACGGCGCAGG + Intronic
1152606617 17:81294772-81294794 CCCCTCTGCGGGGGAGGCGAGGG + Intronic
1152703905 17:81833198-81833220 CCGGGCGGCGGGGACGGGGCGGG - Intronic
1152808814 17:82371691-82371713 GCGCGCGGAGGGGACGGCGCCGG - Intergenic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1157529553 18:48409573-48409595 CCGCGCGGCGGGGAGGGGGCGGG - Intronic
1157849117 18:51030675-51030697 CCCCGGGGCGGGGAAGCCACAGG - Intronic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1160719084 19:589812-589834 CCTCGCGGCGGGGGAGGGGCGGG - Intergenic
1160753269 19:745253-745275 CCCCGATGCGGGGAAGGAGCAGG + Intronic
1160779045 19:869696-869718 CCCTGCTCCGGGGAAGGCCCCGG - Intronic
1160818305 19:1046435-1046457 CCCCGCGGCGGGAAGGTCCCGGG + Intronic
1160844376 19:1160024-1160046 CCGCGTGGCGGGGCAGGCGGGGG - Intronic
1161152653 19:2717800-2717822 ACCCGCCGCGGGGAAGATGCCGG - Exonic
1161324799 19:3658475-3658497 TGCCGTGGCGGGGAAGGCGGAGG - Intronic
1161400856 19:4065809-4065831 CCCCGGGGCGGGGAGGGGGCCGG + Intronic
1161924940 19:7293529-7293551 GCCCGCGGCGGGGCGGGCACCGG + Intronic
1162141000 19:8585551-8585573 TGCCGCGGAGGAGAAGGCGCTGG - Exonic
1162372973 19:10290021-10290043 CGCCGCGGCGGGGAAAGCACAGG - Exonic
1162378908 19:10320827-10320849 GCCCGGGGCTGGGGAGGCGCCGG - Exonic
1162401771 19:10450963-10450985 CCCCTGGGCGGGGCAGGCGGGGG + Intronic
1162496418 19:11025516-11025538 CGCCGCGGCTGGGACGGCTCAGG + Intronic
1162643999 19:12035494-12035516 TCCCGAGGCGGGGGAGGAGCTGG - Intronic
1162687687 19:12401025-12401047 TCCCGAGGCGGGGGAGGGGCTGG - Intronic
1162773629 19:12965555-12965577 CTCCGTGGAGGGGAGGGCGCGGG + Intronic
1162927681 19:13938350-13938372 CCCCAGGGCGGGGAAGGGGGTGG - Exonic
1162954454 19:14090515-14090537 CCCCCCGGGGGGGGAGGCGGAGG - Exonic
1162975694 19:14206236-14206258 CCTCGCGGCGGCGGAGGCTCGGG + Intergenic
1163146197 19:15380385-15380407 CCCCGAGGAGGAGAAGGAGCAGG - Exonic
1163329737 19:16628521-16628543 CCTCGGGGCGGGGAGGGCGGCGG + Intronic
1163607095 19:18281485-18281507 CGGCGCGGCGGGGGAGGCGGAGG - Exonic
1163774917 19:19212297-19212319 CCCCCCGGTGGGGAGGGGGCCGG + Intronic
1163807250 19:19406448-19406470 CCCCGCGGCGGCGGCGGCGGCGG + Intronic
1164813627 19:31177419-31177441 CCCCGAGGCTGGGAAGGCAAGGG - Intergenic
1164989701 19:32675023-32675045 TCCCGCGGGAGGGGAGGCGCAGG + Intronic
1165900484 19:39167210-39167232 CCCCGCAGTGGGGAGGGAGCGGG + Intronic
1166077261 19:40421044-40421066 CCCAGGGGCCGGGAAGGGGCGGG - Intergenic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1168471354 19:56643229-56643251 CCCCGCGGGCGGGAAGGAGGCGG + Intronic
926089999 2:10043536-10043558 CCTCGCGGCGCGGGAGGGGCGGG - Exonic
927215502 2:20666208-20666230 CCCCGCCGCGGTGATGGCGCGGG - Intergenic
927787262 2:25982452-25982474 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
930011418 2:46941032-46941054 CTCCGCGGCGGGGGCGGCGGCGG + Intronic
934882355 2:97995442-97995464 CCCCGCCGCAGGGACGCCGCCGG + Intronic
935046907 2:99490427-99490449 CCCCAAGGCGGGGCAGGCGCGGG - Intergenic
935866468 2:107392559-107392581 GCCCACGGCGGGGTAGCCGCGGG - Intergenic
936104593 2:109613949-109613971 CTCCGCGACGGGGAAGGGACAGG + Exonic
941951307 2:171160200-171160222 CCCCGGGGCGGGGGGGGCGGGGG + Intronic
942560359 2:177212844-177212866 CCCCCCGGCGGCGACGGCGACGG - Exonic
942642187 2:178072164-178072186 CCCCGCCACCGGGAAGGGGCTGG + Exonic
943185190 2:184598376-184598398 CCCGGCGGCGGGGTGGGCGGGGG + Exonic
944451689 2:199850681-199850703 CTCCGCGGGTGGGGAGGCGCGGG - Intronic
944831217 2:203535340-203535362 CCCCGCGGCGGCGGCGGCGGCGG + Exonic
946416625 2:219543297-219543319 CCCGGGGCCGGCGAAGGCGCCGG - Exonic
947801083 2:232928665-232928687 CCTCGCGGTGGGGAGGGGGCCGG + Intronic
948476189 2:238221345-238221367 CCGCTGGGCGGGGAAGGGGCCGG + Intergenic
948824783 2:240568894-240568916 CCCGGGGGCGGAGAAGGCGAAGG - Exonic
948869043 2:240789202-240789224 CCCCGGGTCGGGGGAGGCGGGGG - Intronic
1169214714 20:3786485-3786507 CCCCGGGGCGGGGGGCGCGCCGG - Exonic
1170893799 20:20396560-20396582 CCCCGGGGAGGGGAAGGCCCAGG + Intronic
1171013651 20:21522006-21522028 CCCAGGGGCTGGGAAGGTGCGGG - Intergenic
1171876840 20:30585435-30585457 CCCAGCGCCGGCGCAGGCGCAGG + Intergenic
1172201441 20:33129474-33129496 CCCTGGGGTGGGGAAGGTGCTGG - Intergenic
1172320827 20:33994085-33994107 CCGCGCGGCTGGGAAGGAGGCGG - Exonic
1172367908 20:34363723-34363745 CCCGGCGGCGGGGCCGGCGCGGG + Intronic
1176221197 20:63970003-63970025 CTCCGCGACGGGGAGGGGGCGGG + Intronic
1176573879 21:8433847-8433869 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1177011055 21:15730368-15730390 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1178453738 21:32728069-32728091 CCCCGCGCGAGGGAAGGGGCGGG + Intergenic
1179605563 21:42513608-42513630 CTCGGAGCCGGGGAAGGCGCGGG + Intronic
1179911949 21:44455406-44455428 CGCGGGGGCGGGGAAGGGGCGGG - Intergenic
1180953502 22:19731204-19731226 CACCGCCGCGGGGGAGGGGCGGG + Intergenic
1182532299 22:30969620-30969642 CCCCGCTCCGGGGGAGGCGGCGG + Intergenic
1182692857 22:32175971-32175993 GCCCGGGGAGGGGGAGGCGCTGG + Intergenic
1184412086 22:44331462-44331484 CCCCGGGGCGGGCAGGGCGGGGG - Intergenic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185117453 22:48945791-48945813 CCCAGCGGTGGGGATGGTGCTGG + Intergenic
1185336004 22:50271117-50271139 CCCCGCGGGCGGGCAGGCGCGGG + Intergenic
1203259979 22_KI270733v1_random:167981-168003 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
950018429 3:9769831-9769853 CCCCGCGGCGGGGCAGCCGCAGG - Exonic
950138885 3:10601691-10601713 CCCCGGGGAGGGGAACGCCCAGG + Intronic
951907834 3:27721695-27721717 CACAGCCGCGGGGAAGCCGCCGG + Exonic
955060057 3:55486344-55486366 CCCCGCGCCGGGGTGCGCGCTGG + Intronic
955348480 3:58177933-58177955 CCCTGCGGTGGGGAAGGCGCGGG + Intergenic
957028636 3:75214594-75214616 CCCCCCGGCGGCGACGGCGACGG - Intergenic
960948551 3:122983443-122983465 CCGCGGGGCGGGGACGGGGCGGG + Intronic
961359584 3:126358373-126358395 CCCCACAGCTGGGAAGGAGCAGG + Intergenic
961446284 3:126983204-126983226 CCCCGCGGCGGGGCGGACGGCGG + Intergenic
961929378 3:130517106-130517128 CGCCGGGGCGGGGAAGGGTCGGG + Intergenic
962232029 3:133674376-133674398 CCCCGGGGCTGGGAAGGGGGCGG + Intergenic
962283335 3:134067934-134067956 CCCCGGGGCGAGGAAGGCACAGG + Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
966911421 3:184562257-184562279 CCCGGCGGCGGCGACGGCGGCGG - Exonic
967924187 3:194633387-194633409 GGCGGCGGCGGCGAAGGCGCCGG + Exonic
968093041 3:195909767-195909789 CCCCGGGGCGGCGCAGGCGCAGG - Intronic
968541568 4:1170938-1170960 CCCCGCGGTGGGGACGGGGCTGG - Intronic
969379139 4:6782882-6782904 CCCCTCGGCCGGGTGGGCGCGGG + Intronic
970456140 4:16226269-16226291 ACCGGCGGCGGGAGAGGCGCCGG - Exonic
970617450 4:17781418-17781440 CCACGCGGCGGTGCAGGCGACGG - Exonic
971351828 4:25862635-25862657 CCGCGCGGAGGGGAAGACCCGGG + Intronic
971457808 4:26860792-26860814 CGCCGCGGCGGCGGCGGCGCGGG + Intronic
973317724 4:48779633-48779655 CCCCGCGGGAAGGAAGGCGGTGG - Intronic
975683331 4:76897270-76897292 CTGCGCGGCGGCGAAGACGCAGG - Exonic
979831913 4:125315098-125315120 CTGTGCGGCGGGGAAGGGGCGGG + Intergenic
980130064 4:128809969-128809991 TCCCGCGGCGGCGACGGCGGCGG + Intronic
980130576 4:128812360-128812382 CCGCCCGCCGGGGAATGCGCAGG - Intronic
981067231 4:140498086-140498108 CCCCGCGGCGGGAAAGGAGGCGG + Intronic
981315445 4:143336352-143336374 CCCCGGGGTGGGGGAGGCGGCGG + Intergenic
983296353 4:165873621-165873643 CTCGGAGGCGGGGAGGGCGCAGG - Exonic
984778591 4:183504911-183504933 CCCCTCGGCGGGGCCGGCGCCGG - Intergenic
984811091 4:183797349-183797371 CCCCGCGGGGGCGGAGACGCGGG - Intergenic
985129219 4:186724440-186724462 GCCCGCGGCGGGGAGGGCCTGGG - Intronic
985493263 5:191368-191390 CCCCGAGGCCGGGCAGACGCAGG + Intergenic
985995379 5:3594700-3594722 CCCTGAGCCTGGGAAGGCGCTGG - Intergenic
986721648 5:10564525-10564547 CCCCGGGGTGGGGACGGCGGTGG - Exonic
988796310 5:34656334-34656356 CCCCGCAGCGGGGGAGGAGGAGG + Intronic
988816368 5:34838927-34838949 CCCCTCGGAGGTGAAGGCGTAGG - Intronic
989229993 5:39074480-39074502 CCCCTCGGCGGCGACGGCGGCGG + Intergenic
990955146 5:61332805-61332827 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
992487517 5:77210635-77210657 CGCCGCGGCGGGGAGGGTGGCGG + Intronic
992529577 5:77641479-77641501 CGTCGAGGCGGGGAGGGCGCAGG + Intergenic
997282260 5:132656507-132656529 CCGCGCGTGGGAGAAGGCGCTGG - Intronic
998119156 5:139561746-139561768 CCCCGGGGCGGGGACGGGGGCGG - Exonic
999326939 5:150649598-150649620 CCCCGCGGCGGCGGAGGAGGTGG + Exonic
1000082168 5:157858778-157858800 GCCCGGGGCCGGGAAGGAGCGGG + Intronic
1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG + Exonic
1002439626 5:179257549-179257571 GCCAGCAGCGGGGAGGGCGCAGG - Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005825026 6:29627554-29627576 GCCCGCGGTGGAGATGGCGCTGG - Exonic
1006589088 6:35141204-35141226 ACCCGCGGCGGGGGAGGAGGAGG - Exonic
1006634514 6:35452447-35452469 CGCCGCGTCAGGGACGGCGCTGG + Exonic
1007431483 6:41779820-41779842 CCCCGCGGCCCGGGCGGCGCCGG + Exonic
1007785234 6:44276027-44276049 CGCTGCGGCGGGGCAGGCGGCGG + Exonic
1013117684 6:107115142-107115164 CCACGTGGGGGGGAGGGCGCGGG + Intronic
1013117751 6:107115385-107115407 CCCCGCTGAGGGGGAGGGGCGGG - Intergenic
1014272573 6:119349937-119349959 GCCGGCGGCGGGGAGGTCGCGGG + Intergenic
1015244569 6:131062690-131062712 CCCCGCGGGGGGGATGGAGCCGG + Intronic
1016433028 6:144008005-144008027 CCGCGCTGCGAGGACGGCGCTGG - Intronic
1016597009 6:145814552-145814574 CGCCGCAGCGCGGACGGCGCCGG + Intronic
1017662356 6:156687208-156687230 ACACGCGGCGGGGGAGGAGCGGG + Intergenic
1017737934 6:157381000-157381022 CCCTGGGGTGTGGAAGGCGCGGG - Intergenic
1018017866 6:159727772-159727794 GCCCCCGGCGGGTAAGGGGCGGG + Intronic
1018743086 6:166744866-166744888 CCCAGAGCCGGGGAAGGCCCAGG - Intronic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1019366911 7:638028-638050 CCCGCCGGCGGAGAAGACGCGGG + Intronic
1019474248 7:1236433-1236455 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1019536284 7:1531239-1531261 CCCCGCAGGTGTGAAGGCGCGGG - Intronic
1019776311 7:2913781-2913803 CCCAGCGGAGGGGAGGGCGAGGG + Intronic
1020281527 7:6652582-6652604 CACTGCGGCGGGGAACGCCCAGG - Exonic
1021653575 7:22854094-22854116 GCCCAAGGCGGGGAAGGCCCGGG + Intergenic
1024499819 7:50093150-50093172 CAGCGCGGCGGGGCAGGCGGCGG - Exonic
1024920256 7:54546661-54546683 CCGCGCGGCAGGGACAGCGCCGG + Intronic
1025940858 7:66075630-66075652 CCCCGGGGCGGGGAAGCGGGCGG - Intergenic
1027956073 7:84880802-84880824 GCCCACGGCGGGGGAGGCTCAGG - Intergenic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029268682 7:99362720-99362742 CCCAGCGTCGGGGAAGAGGCGGG + Intronic
1030102104 7:105955898-105955920 CACGGCGGCGGGGTAGGCTCAGG + Intronic
1030215996 7:107044602-107044624 CACCGCGGCGGGGCGGGGGCGGG + Intergenic
1030347960 7:108455288-108455310 CCGCGCGGCGTGGAGGGGGCCGG + Intronic
1034147441 7:148884870-148884892 GCCCGGGGAGGGGAGGGCGCGGG + Intergenic
1034475131 7:151277161-151277183 GCCCGGAGCGGGGGAGGCGCAGG + Intronic
1034617917 7:152435507-152435529 CCCCCCGGCGGGGTGGGGGCGGG - Intronic
1034975909 7:155449246-155449268 TCCCCCGGCGGGGAAGGGGCCGG + Intergenic
1035066411 7:156108427-156108449 CCCCGGGGCGGGGATGGCAGAGG - Intergenic
1035683644 8:1507607-1507629 CGCCGAGGCGGAGGAGGCGCCGG + Intronic
1035747784 8:1974172-1974194 GCCCGCGGCGGGGTGGGCGGCGG + Intronic
1036609119 8:10334577-10334599 TCCCGCGGCCGTGCAGGCGCAGG - Intronic
1037425576 8:18751132-18751154 CACGGAGGCGGGGAAGGCTCAGG + Intronic
1039453847 8:37695665-37695687 CCCCGGGGCGGGGAGAGCGGCGG - Intergenic
1041034627 8:53775989-53776011 CACGGAGGCGGGGAAGGCTCAGG + Intronic
1045304862 8:100950774-100950796 ATCGGTGGCGGGGAAGGCGCTGG - Intronic
1049470752 8:142774116-142774138 TCCCGCTGCGGGGGAGGGGCTGG + Intronic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1049854554 8:144853146-144853168 CCCCCGGGCGGGGAGGGGGCGGG - Intronic
1051936476 9:22447626-22447648 CCCTGCGGCGGGGGCTGCGCTGG + Exonic
1052362214 9:27573444-27573466 GCCCGCGGCGGCGGAGGCGCAGG - Intronic
1053142673 9:35690939-35690961 GGCTGCGGCGGGGAAGGCGGAGG + Exonic
1056992573 9:91424471-91424493 CGCTGCGGCGGGGAAGGGGTTGG + Intergenic
1057179346 9:93021458-93021480 GCCCGCTGCGAGGAAGGCCCTGG + Intronic
1057489146 9:95508369-95508391 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1057490429 9:95516191-95516213 CCGCGTGGCGGGGAGGGGGCTGG - Intronic
1057555865 9:96087124-96087146 CCCCGAGGCTGGGAAAGCCCTGG + Intergenic
1059230678 9:112718307-112718329 GCCCGGGGCGGGGGAGGGGCGGG + Intergenic
1060629566 9:125143438-125143460 TCCCGCGGCGGAGCAGGAGCCGG - Exonic
1061490093 9:130939706-130939728 CCCGGCGGAGGAGAAGGCGGGGG - Intergenic
1061624876 9:131835708-131835730 CCCAGCCTCTGGGAAGGCGCAGG + Intergenic
1062052780 9:134456148-134456170 GACCGCGGCCGGGAAGGAGCAGG - Intergenic
1062332749 9:136051691-136051713 CCCCGCTGCGGAGAAGTTGCCGG + Intronic
1062332794 9:136051845-136051867 CCCTGGGGCGGGGAGGGCGCAGG + Intronic
1062362102 9:136193080-136193102 CCCCGCGGAGCGGGAGGTGCGGG - Intergenic
1062519074 9:136950186-136950208 CCCCACCGCGGGGCAGACGCAGG - Intronic
1062533353 9:137011153-137011175 CCGTGGGGCGGGGAAGGCGGTGG - Intronic
1062540781 9:137040825-137040847 CCCCGGGGAGGGCAAGGCGACGG - Exonic
1062637585 9:137499700-137499722 CCCCGAGCCGGGCAAGGGGCAGG - Intronic
1203468330 Un_GL000220v1:106049-106071 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1203476151 Un_GL000220v1:150021-150043 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1187826108 X:23334544-23334566 CCCCCTGGCGGGGAGGCCGCGGG + Exonic
1189821484 X:44873380-44873402 CGCGGCGGCGGTGAAGGCGGCGG - Intronic
1190415964 X:50180748-50180770 GCTCGGGGCGGGGAAGGAGCAGG - Intergenic
1190598240 X:52067023-52067045 CACCAAGTCGGGGAAGGCGCTGG - Exonic
1190610584 X:52187050-52187072 CACCAAGTCGGGGAAGGCGCTGG + Exonic
1200163336 X:154020013-154020035 CCCCGCGCCGGGGAGGGCCCGGG + Intergenic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic