ID: 1064030048

View in Genome Browser
Species Human (GRCh38)
Location 10:11877783-11877805
Sequence ACGCAGTGCTTCCCAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064030048_1064030058 21 Left 1064030048 10:11877783-11877805 CCAGTATCTGGGAAGCACTGCGT No data
Right 1064030058 10:11877827-11877849 CCACCCCGACCCCAGCTCAGGGG No data
1064030048_1064030056 20 Left 1064030048 10:11877783-11877805 CCAGTATCTGGGAAGCACTGCGT No data
Right 1064030056 10:11877826-11877848 TCCACCCCGACCCCAGCTCAGGG No data
1064030048_1064030059 22 Left 1064030048 10:11877783-11877805 CCAGTATCTGGGAAGCACTGCGT No data
Right 1064030059 10:11877828-11877850 CACCCCGACCCCAGCTCAGGGGG No data
1064030048_1064030063 29 Left 1064030048 10:11877783-11877805 CCAGTATCTGGGAAGCACTGCGT No data
Right 1064030063 10:11877835-11877857 ACCCCAGCTCAGGGGGCAGCAGG No data
1064030048_1064030055 19 Left 1064030048 10:11877783-11877805 CCAGTATCTGGGAAGCACTGCGT No data
Right 1064030055 10:11877825-11877847 CTCCACCCCGACCCCAGCTCAGG No data
1064030048_1064030065 30 Left 1064030048 10:11877783-11877805 CCAGTATCTGGGAAGCACTGCGT No data
Right 1064030065 10:11877836-11877858 CCCCAGCTCAGGGGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064030048 Original CRISPR ACGCAGTGCTTCCCAGATAC TGG (reversed) Intergenic
No off target data available for this crispr