ID: 1064031691

View in Genome Browser
Species Human (GRCh38)
Location 10:11887001-11887023
Sequence GAAGGGGCTCCGGGAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064031691_1064031704 23 Left 1064031691 10:11887001-11887023 CCAGGGCTTCCCGGAGCCCCTTC No data
Right 1064031704 10:11887047-11887069 TCCCGAAAGCCCCGCAGGAGGGG No data
1064031691_1064031703 22 Left 1064031691 10:11887001-11887023 CCAGGGCTTCCCGGAGCCCCTTC No data
Right 1064031703 10:11887046-11887068 GTCCCGAAAGCCCCGCAGGAGGG No data
1064031691_1064031707 30 Left 1064031691 10:11887001-11887023 CCAGGGCTTCCCGGAGCCCCTTC No data
Right 1064031707 10:11887054-11887076 AGCCCCGCAGGAGGGGTCTGAGG No data
1064031691_1064031702 21 Left 1064031691 10:11887001-11887023 CCAGGGCTTCCCGGAGCCCCTTC No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031691_1064031701 18 Left 1064031691 10:11887001-11887023 CCAGGGCTTCCCGGAGCCCCTTC No data
Right 1064031701 10:11887042-11887064 CCATGTCCCGAAAGCCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064031691 Original CRISPR GAAGGGGCTCCGGGAAGCCC TGG (reversed) Intergenic