ID: 1064031694

View in Genome Browser
Species Human (GRCh38)
Location 10:11887011-11887033
Sequence GCCTGGAGGAGAAGGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064031694_1064031707 20 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031707 10:11887054-11887076 AGCCCCGCAGGAGGGGTCTGAGG No data
1064031694_1064031701 8 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031701 10:11887042-11887064 CCATGTCCCGAAAGCCCCGCAGG No data
1064031694_1064031702 11 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031694_1064031703 12 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031703 10:11887046-11887068 GTCCCGAAAGCCCCGCAGGAGGG No data
1064031694_1064031704 13 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031704 10:11887047-11887069 TCCCGAAAGCCCCGCAGGAGGGG No data
1064031694_1064031708 21 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031708 10:11887055-11887077 GCCCCGCAGGAGGGGTCTGAGGG No data
1064031694_1064031710 22 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031710 10:11887056-11887078 CCCCGCAGGAGGGGTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064031694 Original CRISPR GCCTGGAGGAGAAGGGGCTC CGG (reversed) Intergenic