ID: 1064031699

View in Genome Browser
Species Human (GRCh38)
Location 10:11887028-11887050
Sequence GGGACATGGCTTCTCTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064031699_1064031703 -5 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031703 10:11887046-11887068 GTCCCGAAAGCCCCGCAGGAGGG No data
1064031699_1064031710 5 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031710 10:11887056-11887078 CCCCGCAGGAGGGGTCTGAGGGG No data
1064031699_1064031704 -4 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031704 10:11887047-11887069 TCCCGAAAGCCCCGCAGGAGGGG No data
1064031699_1064031701 -9 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031701 10:11887042-11887064 CCATGTCCCGAAAGCCCCGCAGG No data
1064031699_1064031702 -6 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031699_1064031708 4 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031708 10:11887055-11887077 GCCCCGCAGGAGGGGTCTGAGGG No data
1064031699_1064031707 3 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031707 10:11887054-11887076 AGCCCCGCAGGAGGGGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064031699 Original CRISPR GGGACATGGCTTCTCTTGCC TGG (reversed) Intergenic