ID: 1064031702

View in Genome Browser
Species Human (GRCh38)
Location 10:11887045-11887067
Sequence TGTCCCGAAAGCCCCGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064031699_1064031702 -6 Left 1064031699 10:11887028-11887050 CCAGGCAAGAGAAGCCATGTCCC No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031691_1064031702 21 Left 1064031691 10:11887001-11887023 CCAGGGCTTCCCGGAGCCCCTTC No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031695_1064031702 5 Left 1064031695 10:11887017-11887039 CCCCTTCTCCTCCAGGCAAGAGA No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031692_1064031702 12 Left 1064031692 10:11887010-11887032 CCCGGAGCCCCTTCTCCTCCAGG No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031697_1064031702 3 Left 1064031697 10:11887019-11887041 CCTTCTCCTCCAGGCAAGAGAAG No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031694_1064031702 11 Left 1064031694 10:11887011-11887033 CCGGAGCCCCTTCTCCTCCAGGC No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031698_1064031702 -3 Left 1064031698 10:11887025-11887047 CCTCCAGGCAAGAGAAGCCATGT No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data
1064031696_1064031702 4 Left 1064031696 10:11887018-11887040 CCCTTCTCCTCCAGGCAAGAGAA No data
Right 1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064031702 Original CRISPR TGTCCCGAAAGCCCCGCAGG AGG Intergenic
No off target data available for this crispr