ID: 1064032826

View in Genome Browser
Species Human (GRCh38)
Location 10:11894004-11894026
Sequence AGGCCAGATGGCCCCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064032826_1064032837 14 Left 1064032826 10:11894004-11894026 CCACAGGAGGGGCCATCTGGCCT No data
Right 1064032837 10:11894041-11894063 CTTCAGCAGGCGGCAGGGACGGG No data
1064032826_1064032834 8 Left 1064032826 10:11894004-11894026 CCACAGGAGGGGCCATCTGGCCT No data
Right 1064032834 10:11894035-11894057 AGGCAGCTTCAGCAGGCGGCAGG No data
1064032826_1064032836 13 Left 1064032826 10:11894004-11894026 CCACAGGAGGGGCCATCTGGCCT No data
Right 1064032836 10:11894040-11894062 GCTTCAGCAGGCGGCAGGGACGG No data
1064032826_1064032832 1 Left 1064032826 10:11894004-11894026 CCACAGGAGGGGCCATCTGGCCT No data
Right 1064032832 10:11894028-11894050 GGCATTCAGGCAGCTTCAGCAGG No data
1064032826_1064032835 9 Left 1064032826 10:11894004-11894026 CCACAGGAGGGGCCATCTGGCCT No data
Right 1064032835 10:11894036-11894058 GGCAGCTTCAGCAGGCGGCAGGG No data
1064032826_1064032833 4 Left 1064032826 10:11894004-11894026 CCACAGGAGGGGCCATCTGGCCT No data
Right 1064032833 10:11894031-11894053 ATTCAGGCAGCTTCAGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064032826 Original CRISPR AGGCCAGATGGCCCCTCCTG TGG (reversed) Intergenic
No off target data available for this crispr