ID: 1064033406

View in Genome Browser
Species Human (GRCh38)
Location 10:11897494-11897516
Sequence CGGCTGGTCACTTGTAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064033406_1064033419 24 Left 1064033406 10:11897494-11897516 CCAAGATTACAAGTGACCAGCCG No data
Right 1064033419 10:11897541-11897563 CCCAGCAGTTTGGGAGGCTGAGG 0: 1308
1: 92697
2: 223357
3: 342520
4: 365706
1064033406_1064033417 18 Left 1064033406 10:11897494-11897516 CCAAGATTACAAGTGACCAGCCG No data
Right 1064033417 10:11897535-11897557 TGTAATCCCAGCAGTTTGGGAGG 0: 3819
1: 309289
2: 271603
3: 206826
4: 226724
1064033406_1064033421 28 Left 1064033406 10:11897494-11897516 CCAAGATTACAAGTGACCAGCCG No data
Right 1064033421 10:11897545-11897567 GCAGTTTGGGAGGCTGAGGCAGG 0: 892
1: 66043
2: 192068
3: 322916
4: 371531
1064033406_1064033415 15 Left 1064033406 10:11897494-11897516 CCAAGATTACAAGTGACCAGCCG No data
Right 1064033415 10:11897532-11897554 GCCTGTAATCCCAGCAGTTTGGG 0: 2757
1: 231714
2: 280934
3: 229260
4: 268565
1064033406_1064033412 -7 Left 1064033406 10:11897494-11897516 CCAAGATTACAAGTGACCAGCCG No data
Right 1064033412 10:11897510-11897532 CCAGCCGGGCATGGTGGCTCAGG No data
1064033406_1064033414 14 Left 1064033406 10:11897494-11897516 CCAAGATTACAAGTGACCAGCCG No data
Right 1064033414 10:11897531-11897553 GGCCTGTAATCCCAGCAGTTTGG 0: 60
1: 7995
2: 239409
3: 287552
4: 269404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064033406 Original CRISPR CGGCTGGTCACTTGTAATCT TGG (reversed) Intergenic
No off target data available for this crispr