ID: 1064043589

View in Genome Browser
Species Human (GRCh38)
Location 10:11990430-11990452
Sequence CGGCCTCCTAACCCTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064043589_1064043596 23 Left 1064043589 10:11990430-11990452 CCTTAAAAAGGGTTAGGAGGCCG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1064043596 10:11990476-11990498 CGAGACCATCCTAGCTAACATGG 0: 675
1: 38233
2: 52400
3: 92709
4: 173527
1064043589_1064043594 -4 Left 1064043589 10:11990430-11990452 CCTTAAAAAGGGTTAGGAGGCCG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1064043594 10:11990449-11990471 GCCGGGTGGATCACGAGGTCAGG 0: 45
1: 10824
2: 46851
3: 61080
4: 53728
1064043589_1064043593 -9 Left 1064043589 10:11990430-11990452 CCTTAAAAAGGGTTAGGAGGCCG 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1064043593 10:11990444-11990466 AGGAGGCCGGGTGGATCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064043589 Original CRISPR CGGCCTCCTAACCCTTTTTA AGG (reversed) Intronic
904096273 1:27980502-27980524 TGGCCTCTTAATCCTTTTAAAGG - Intronic
907411405 1:54286347-54286369 GGGCCTCATCACCCTGTTTAAGG - Intronic
914947236 1:152078624-152078646 CGGCCCCCTCACCGTTTGTAAGG - Intergenic
918532792 1:185541530-185541552 CTGCCTCCTAACCCTTACTTTGG - Intergenic
922558890 1:226553050-226553072 CAGCCTACTAAACCTTTTGAAGG + Intronic
1064043589 10:11990430-11990452 CGGCCTCCTAACCCTTTTTAAGG - Intronic
1069112450 10:64464370-64464392 CTGCCTCCTAGCCATTTTCATGG + Intergenic
1070654374 10:78261392-78261414 CAGCCTCCTAAACCACTTTAAGG - Intergenic
1085799250 11:79573195-79573217 CCACCTCCTATCCCTTTTTCTGG - Intergenic
1095909351 12:47410144-47410166 CACCCTCCTAACCATTGTTATGG + Intergenic
1099182923 12:79488279-79488301 CGGCCTCCTTCTACTTTTTAAGG - Intergenic
1105357539 13:19672609-19672631 AGGCCTCCCAACCCTTTCAAGGG - Exonic
1110626350 13:77660084-77660106 CGGCCCCCTCACCGTTTGTAAGG - Intergenic
1112857413 13:103788042-103788064 CACCCTCCTCACCCTTTTTGTGG + Intergenic
1115768518 14:36647448-36647470 CGGCCTCAGAACCCCGTTTACGG + Intergenic
1119216151 14:72870775-72870797 CAGCCTCGTTACCCTTTTAATGG - Intronic
1124434398 15:29635138-29635160 CGGCCTCCTTAGGGTTTTTATGG + Intergenic
1128018349 15:64367843-64367865 CAGCCTCATTACACTTTTTATGG + Intronic
1128302585 15:66575889-66575911 CGGCCACCTCGCTCTTTTTAAGG + Intergenic
1135731304 16:24897249-24897271 CAGCCTCCTTTGCCTTTTTAAGG + Intronic
1138829162 16:60357885-60357907 CAGCCCCCTCACCCTTTGTAAGG - Intergenic
1140880108 16:79190320-79190342 CGGCCTCATATCCTTTTTTATGG + Intronic
1140903801 16:79393558-79393580 GGGCCTCCTCACTCTTTTTTAGG + Intergenic
1141866248 16:86752031-86752053 CGGCCTCCAAACCCCCTTTTGGG + Intergenic
1145015945 17:19398298-19398320 AGGCCTCATAATTCTTTTTAAGG - Intergenic
1146716108 17:35088710-35088732 CGGCCTGCTTACCCCTTTAAAGG - Intronic
1148222357 17:45871988-45872010 AGGCCTCCCCTCCCTTTTTAGGG - Intergenic
1148438904 17:47701741-47701763 CGGCCTCCTAGCCCCTTATAGGG - Intronic
1153882702 18:9434668-9434690 CGGCCTGTAACCCCTTTTTAAGG - Intergenic
1156413806 18:36865858-36865880 TGTCCTCCTTACCCTTTTTCTGG + Intronic
1162838665 19:13339505-13339527 TGTCATCCTAACCATTTTTAAGG - Intronic
1165962939 19:39550669-39550691 CGGCCTCCTCTCCTTTTTTGTGG + Intergenic
929538219 2:42798511-42798533 CGGCCTCTTGAGCCTCTTTATGG + Intergenic
937015951 2:118605646-118605668 CTGCACCCTAACCCTTTTTGGGG - Intergenic
938149137 2:128866333-128866355 CGGCCTCAGAACCCTTTATCTGG - Intergenic
945227953 2:207552087-207552109 CAGCCTACCAATCCTTTTTAGGG - Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1172186447 20:33034064-33034086 CGGCCTCCTATCCCATGTCATGG - Intronic
1173880025 20:46405538-46405560 CGGCGTCCCACCCCTTTGTAGGG - Intronic
1174629836 20:51946651-51946673 CAGCCTTCTGTCCCTTTTTAAGG + Intergenic
954673604 3:52303673-52303695 CTGCCTCCTAGCCCTGTATAAGG - Intergenic
961309936 3:125990321-125990343 CGGCTTCTTAACCCTTTTCTCGG + Intergenic
962736404 3:138329457-138329479 CGGCCCCCGGCCCCTTTTTAAGG + Intronic
964744545 3:160000170-160000192 CATCCTAATAACCCTTTTTATGG + Intergenic
967566272 3:190977113-190977135 CTTCCTTCTAACCCTTCTTAAGG + Intergenic
967918518 3:194597359-194597381 CAGCCTCCTATACCTTTTAAAGG - Intronic
976918260 4:90405027-90405049 CGACCTTCTAATTCTTTTTACGG - Intronic
979953739 4:126927921-126927943 CGGCCTCCTAATTCTTTTAAAGG + Intergenic
982158076 4:152540646-152540668 CTGCCTCCTACCACTTTTCATGG + Intergenic
983347809 4:166548901-166548923 CAGCCTCCTAAGTCATTTTAAGG - Intergenic
984899247 4:184570046-184570068 CGGCCTCTAAATTCTTTTTATGG + Intergenic
1002508625 5:179698514-179698536 CGGACTCCTACCCCTTTTGCCGG + Intronic
1008106654 6:47446105-47446127 TGGCCTTCTATTCCTTTTTAAGG - Intergenic
1009651358 6:66480962-66480984 GGGCATCTTCACCCTTTTTATGG + Intergenic
1012941946 6:105424724-105424746 TGGTTTCCTAACTCTTTTTAAGG - Intergenic
1015202997 6:130603513-130603535 TGGCCTCCTAAGACTTTTTAGGG - Intergenic
1026986961 7:74560876-74560898 CGACCTCCTGACCCTTTTTAAGG + Intronic
1029423067 7:100481398-100481420 CGGCCTCTAACCCCTCTTTAGGG + Intergenic
1030344339 7:108415582-108415604 CGGCCTTCTTCTCCTTTTTATGG - Intronic
1038823613 8:30976619-30976641 CGGCCTCCAAATCACTTTTAAGG + Intergenic
1044891997 8:96846113-96846135 CAGCCTCCTAACTTTTTTTAAGG + Intronic
1048298371 8:133233278-133233300 CAGCTTCCTCTCCCTTTTTATGG - Intergenic
1055837420 9:80460005-80460027 AGGCCTCCTAACCCTCTTGATGG + Intergenic
1056019948 9:82430996-82431018 CGGCCCCCTCACCGTTTGTAAGG - Intergenic
1057071893 9:92106037-92106059 CGGCCCCCTCACCGTTTGTAAGG + Intronic
1196250253 X:113451983-113452005 AGCTCTCCAAACCCTTTTTATGG - Intergenic