ID: 1064056113

View in Genome Browser
Species Human (GRCh38)
Location 10:12098925-12098947
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064056106_1064056113 11 Left 1064056106 10:12098891-12098913 CCAGGCACGGTGGCTCCTATCTG 0: 1
1: 37
2: 1290
3: 19121
4: 79432
Right 1064056113 10:12098925-12098947 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1064056107_1064056113 -4 Left 1064056107 10:12098906-12098928 CCTATCTGTAATACCAGTGCTTT 0: 1
1: 3
2: 43
3: 244
4: 1483
Right 1064056113 10:12098925-12098947 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064056113 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr