ID: 1064062892

View in Genome Browser
Species Human (GRCh38)
Location 10:12154088-12154110
Sequence GGACGACATGTATGATGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064062892_1064062896 4 Left 1064062892 10:12154088-12154110 CCGGCTCATCATACATGTCGTCC 0: 1
1: 0
2: 1
3: 2
4: 62
Right 1064062896 10:12154115-12154137 CCCGTGAACATGTAGCAGTTAGG No data
1064062892_1064062899 11 Left 1064062892 10:12154088-12154110 CCGGCTCATCATACATGTCGTCC 0: 1
1: 0
2: 1
3: 2
4: 62
Right 1064062899 10:12154122-12154144 ACATGTAGCAGTTAGGGTTCTGG No data
1064062892_1064062898 5 Left 1064062892 10:12154088-12154110 CCGGCTCATCATACATGTCGTCC 0: 1
1: 0
2: 1
3: 2
4: 62
Right 1064062898 10:12154116-12154138 CCGTGAACATGTAGCAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064062892 Original CRISPR GGACGACATGTATGATGAGC CGG (reversed) Intronic
901007735 1:6179936-6179958 GGACGAGATGTCAGGTGAGCGGG - Exonic
906138086 1:43514547-43514569 GCACGAGATGTACGATGACCAGG - Intergenic
908663147 1:66460313-66460335 GGACAACATGTATGAATAGATGG - Intergenic
912421239 1:109543682-109543704 AGACCACAAGTATGAGGAGCAGG - Exonic
915050168 1:153060884-153060906 GGAAGAGATGGATGATTAGCAGG + Intergenic
916516381 1:165521348-165521370 TGACAACAGGTATGATGAGATGG + Intergenic
1063484155 10:6403433-6403455 TGAAGACATGAATGCTGAGCTGG - Intergenic
1064062892 10:12154088-12154110 GGACGACATGTATGATGAGCCGG - Intronic
1075964972 10:126603500-126603522 GGATGACATGCATGATGATATGG - Intronic
1078316713 11:10299492-10299514 AGATCACATGTTTGATGAGCAGG + Intergenic
1078351016 11:10593504-10593526 GGAGGGAATGGATGATGAGCTGG + Exonic
1079390418 11:20017408-20017430 GGAAGACATGAAAGATGAGAGGG - Intronic
1084287402 11:68141116-68141138 GGACCACACGCATGAGGAGCAGG + Intergenic
1087182805 11:95156379-95156401 GGAGGCCATCCATGATGAGCTGG - Intergenic
1091775767 12:3183775-3183797 GGACTAGATGTATGAAGACCCGG + Intronic
1093947901 12:25131229-25131251 GGACTACATGTAAGATCAGTAGG - Intronic
1105219522 13:18312793-18312815 GGAGGACATGCATGATCCGCTGG - Intergenic
1119415226 14:74465377-74465399 GGAGGAGAGGTAGGATGAGCCGG - Intergenic
1130824234 15:87527472-87527494 GGATGACATGCAGGATAAGCTGG + Intergenic
1132518121 16:375331-375353 GCACCACAGGTATGATGGGCAGG - Exonic
1133349455 16:5091847-5091869 GGACGAGCTGTATGAAGCGCTGG - Exonic
1134596441 16:15499723-15499745 GAACAACCTGAATGATGAGCTGG - Intronic
1142566581 17:844138-844160 GGACGGGATGTATGATGGCCTGG - Intronic
1142955487 17:3518671-3518693 GGATGACATAGGTGATGAGCAGG + Exonic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1148861547 17:50606944-50606966 GGACATCATGTACGATGGGCTGG + Exonic
1154980789 18:21500608-21500630 GGTGGACGTGTATGATGAGGAGG + Exonic
1156849658 18:41711839-41711861 GGATGAGGTGTAAGATGAGCAGG + Intergenic
1162231728 19:9272145-9272167 GGACGACATGAATGATAGACTGG - Intergenic
1162737818 19:12756158-12756180 GGACGAGATGTATGATGACCTGG + Exonic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
926827673 2:16923640-16923662 GTAGGACAAGTAAGATGAGCAGG - Intergenic
934184527 2:89659725-89659747 GGAGGACATGCATGATCCGCTGG + Intergenic
934294809 2:91733862-91733884 GGAGGACATGCATGATCCGCTGG + Intergenic
935192642 2:100791295-100791317 TGACTACATTTAAGATGAGCCGG + Intergenic
938633420 2:133195176-133195198 GGACAACATGAATGATCAGATGG + Intronic
947241529 2:227999838-227999860 GGATGACATGTAAGATAAGAAGG - Intronic
1169227693 20:3866418-3866440 GGAGGACATGGATGATAACCTGG - Exonic
1172444706 20:34986950-34986972 GGACAACATGAATGATGGGGAGG + Exonic
1182859244 22:33544988-33545010 GGAAGAAACGTATGCTGAGCAGG + Intronic
952399995 3:32954450-32954472 GGACTGCGTGTAAGATGAGCTGG - Exonic
954473647 3:50722726-50722748 GGACAACATGTATGAACAGATGG + Intronic
955660683 3:61295529-61295551 GGTGGGGATGTATGATGAGCAGG + Intergenic
957938421 3:86973701-86973723 GGAGGGCCTGTCTGATGAGCTGG - Intronic
961301085 3:125922490-125922512 GGACGAGCTGTATGAGGTGCTGG + Intergenic
961868052 3:129968359-129968381 GGACGAGTTGAATGCTGAGCAGG - Intergenic
963738013 3:149043156-149043178 GGAAGAGATGAAAGATGAGCTGG + Intronic
966708582 3:182946729-182946751 GGAAGACATGAATGCTGAGTAGG + Intronic
976453742 4:85221940-85221962 GGACGACATATATGAAGTGCTGG - Intergenic
976824672 4:89248043-89248065 GGACGTCGTGTGGGATGAGCAGG - Exonic
979795633 4:124843225-124843247 GGACAACATGAATGATCAGGTGG - Intergenic
981224661 4:142278903-142278925 GGATGACAAGTATGAGGAACAGG + Intronic
987073327 5:14358216-14358238 GGACGACGTGTATGCCGAGTCGG + Exonic
988613796 5:32753845-32753867 TGAAGACATGTCTCATGAGCAGG - Intronic
988895811 5:35673616-35673638 AGACAACATGGATGATGTGCTGG - Intronic
995446613 5:112251850-112251872 GGAAGACATGAATGATAAGAAGG + Intronic
999241137 5:150128065-150128087 GACCGAGATGTGTGATGAGCGGG - Intronic
1005137035 6:22581025-22581047 TGACTGCATGTATAATGAGCAGG - Intergenic
1013953354 6:115811734-115811756 TGACCACATGAATGATAAGCAGG + Intergenic
1026364379 7:69633068-69633090 GGAGGAGATGTAGGATGAACAGG - Intronic
1026615326 7:71897456-71897478 GGAAGAAATGTGTGCTGAGCTGG - Intronic
1036089275 8:5647707-5647729 GGAAGACAGGTCTGATGACCTGG - Intergenic
1036574606 8:10015037-10015059 AGAAGACATGTGTGATGTGCTGG - Intergenic
1040538105 8:48327155-48327177 GGAAGACTTGTAGGAAGAGCTGG + Intergenic
1050900028 9:10935910-10935932 GGACCACATGAATGATTAGAAGG - Intergenic
1060686684 9:125620861-125620883 GGACGACATGAATGGTGGACAGG + Intronic