ID: 1064063358

View in Genome Browser
Species Human (GRCh38)
Location 10:12158800-12158822
Sequence CTGGAGGCAGGGTGGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 0, 2: 8, 3: 95, 4: 883}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064063358_1064063369 6 Left 1064063358 10:12158800-12158822 CCTATCTCCCACCCTGCCTCCAG 0: 1
1: 0
2: 8
3: 95
4: 883
Right 1064063369 10:12158829-12158851 TCCATTTTTCATGGTCTGAATGG No data
1064063358_1064063366 -3 Left 1064063358 10:12158800-12158822 CCTATCTCCCACCCTGCCTCCAG 0: 1
1: 0
2: 8
3: 95
4: 883
Right 1064063366 10:12158820-12158842 CAGGCCTCCTCCATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064063358 Original CRISPR CTGGAGGCAGGGTGGGAGAT AGG (reversed) Intronic
900186612 1:1336025-1336047 CGGGAGGCAGGGTGGGGGGCAGG - Exonic
900195488 1:1373624-1373646 CGGGCAGCAGGGTGGCAGATTGG - Intergenic
900370371 1:2329518-2329540 CTGGCCCCAGGGTGGGGGATTGG - Intronic
900400380 1:2470643-2470665 CGGGAGGGAGGGTGGCAGCTGGG - Intronic
900556483 1:3283381-3283403 CAGGAGGGAGGGAGGGAGAGAGG - Intronic
900565723 1:3331054-3331076 CTGGAGCCCGGGTGGGCGGTGGG - Intronic
900574000 1:3374065-3374087 CTGGAGGGAGTGTGGTATATCGG + Intronic
900611071 1:3544862-3544884 CTGGGGGCAGGGTGGCCGAGGGG + Intronic
900862939 1:5246024-5246046 AGGGAGGGAGGGAGGGAGATGGG - Intergenic
901051264 1:6426918-6426940 AAGGAGGCAGGGAGGAAGATGGG - Intronic
901078204 1:6568813-6568835 CTGGAAGGAGGGTGGAAGAGAGG + Intronic
901418548 1:9134721-9134743 CTGTAAGCAAGGTGGGAGGTGGG - Intergenic
901624447 1:10616088-10616110 CCGCAGGCAGGGAGGGAGTTTGG + Intronic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
901842808 1:11964532-11964554 CTGGAGTCTGGGTGTGAGAAGGG - Intronic
902383467 1:16063538-16063560 CTGGAGCCACGGTGGGAGTGCGG + Exonic
902557597 1:17256137-17256159 CTGGAGGCAGGATGAGACAGTGG - Intronic
902628310 1:17689491-17689513 AGGGAGGCAGGGAGGGAGAGAGG - Intronic
902773917 1:18662109-18662131 CTGGGGGTAGGGTGGGTGCTGGG + Intronic
902991399 1:20189866-20189888 CTGGTGGCAGAGCTGGAGATAGG - Intronic
903225543 1:21892514-21892536 CCAGCTGCAGGGTGGGAGATGGG - Intronic
903364494 1:22797640-22797662 GAGGAGGCAGGGTGGGAGCAGGG - Intronic
903576077 1:24340691-24340713 CTGGAGGCAGGCAGGGAGGCAGG - Intronic
903668587 1:25022486-25022508 CCGGAGGCAGGCCGGGAGCTGGG - Intergenic
904203474 1:28836921-28836943 ATGGGGGCAGGGTGGGGGAACGG + Intronic
904451545 1:30616027-30616049 CAGGAGGCAAGTTGTGAGATGGG - Intergenic
904592941 1:31625394-31625416 CTGCACCCAGGGTGGGAGTTGGG - Intronic
904771821 1:32885174-32885196 TTGGGGGCAAGGTGGGAGAAGGG - Intergenic
904776285 1:32909082-32909104 CTGGAGGGAGGTTGAGAGAGGGG + Intergenic
904876246 1:33656654-33656676 GGGGAGGCAGTGTGGGAGGTAGG + Intronic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905415203 1:37799283-37799305 ATGGAGGCAGGATGGGAGCCTGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905615165 1:39391962-39391984 CTGGAAGAAGAGTGGGAGAAGGG + Intronic
905731663 1:40302810-40302832 CTGGAGGGAGGGAGGGAGGGAGG + Intronic
905784751 1:40745695-40745717 CTGGAGGGAGAGTGAGGGATTGG - Intronic
905888257 1:41503273-41503295 CTGGAGCCCGAGTGTGAGATGGG + Intergenic
906296459 1:44651803-44651825 CTGGTGGCAGGATGGGGGAAAGG + Intronic
906474186 1:46156821-46156843 GTTGAGGCATGGTAGGAGATGGG - Intronic
906480398 1:46195754-46195776 CTAGAAGCAGGGTTGGAGCTAGG + Intronic
906484209 1:46221976-46221998 CTGGGGACAGGGTGGGGGAAGGG - Intergenic
906789968 1:48650497-48650519 AAGGAGGCAAGGAGGGAGATAGG - Intronic
906800800 1:48735383-48735405 ATGGAGGGAGGGTGGGAGAGAGG + Intronic
907778083 1:57538406-57538428 ATGGAGCCAGGGAGGGAGGTAGG - Intronic
908232741 1:62121980-62122002 TTGGGGGCAGGGTGGGACAAGGG + Intronic
909043962 1:70686741-70686763 CTGGAGGCAGGAGGGTCGATGGG + Intergenic
911208691 1:95117763-95117785 CTGGAGGCTGGGTGGGCGTCCGG + Intronic
911620805 1:100064976-100064998 CTTGAGGCAGGGAGGTAGAGGGG - Intronic
912223128 1:107700449-107700471 CTGTAAGCAGGGTGGGGGAAAGG - Intronic
912297084 1:108480506-108480528 CCAGAGGAGGGGTGGGAGATGGG - Intergenic
912409075 1:109467197-109467219 ATGGAGCCAGGGTGGGGGCTGGG + Intronic
912496853 1:110097451-110097473 CTGGAGTCAGGTTGGGGTATGGG + Intergenic
912741157 1:112198891-112198913 TGGGAGGCAGGGTGGAGGATGGG - Intergenic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
914998214 1:152563285-152563307 GTGGAGAGAGGGAGGGAGATGGG + Intronic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
915482491 1:156196449-156196471 ATGGAGACAAGGTGGGAAATCGG + Intronic
915490274 1:156246757-156246779 CTAGAGACAGAGTGGGAGGTAGG + Intronic
915722122 1:157993326-157993348 AGGGAGGCAGGGAGGGAGAGAGG + Intronic
915903410 1:159862126-159862148 CTGGAGGTGGGGTAGGAGAGGGG - Intronic
915906492 1:159881894-159881916 CTGGAAACAGTGTGGGAGGTGGG - Intronic
916553594 1:165873819-165873841 CAGGAGGGAGGGAGGGAGAATGG - Intronic
916837358 1:168560868-168560890 CTGGAGGCTTGGTGGGAGAGAGG + Intergenic
917149891 1:171932043-171932065 ATGGAGGGAGGGTGGGGGATGGG - Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917745139 1:177999499-177999521 CTGGAGGCAGTGTGAGGGAGTGG - Intergenic
917782306 1:178411394-178411416 TGGGAGGAAGGGTGGGAGATGGG + Intronic
918393753 1:184093332-184093354 TTGGAGGCAGGGTGGTGGAGTGG + Intergenic
918733082 1:188022889-188022911 CTGGGGTCAGGGAGGGAGAGTGG + Intergenic
918802011 1:188984800-188984822 AGGGAGGAAGGGTGGGAGAGAGG - Intergenic
919022859 1:192130339-192130361 GAGGAGGCAGGGTGGGGGGTAGG + Intergenic
919056267 1:192573208-192573230 CTGGAGGCAAGGTGAAAGGTGGG + Intergenic
920333881 1:205230993-205231015 CTGGGGGCGGGGGGGGGGATGGG - Intronic
920389365 1:205589334-205589356 CGGTAGGCAGGGTGGGGGATCGG + Intronic
921761783 1:218923478-218923500 CTGGAGTCAGGGAGCGAGCTGGG - Intergenic
922801979 1:228368611-228368633 CCGGGGGCAGGGTGGGACAGTGG - Intronic
922980102 1:229818510-229818532 CTGGTGGTAGAGTGGGAAATTGG - Intergenic
923645629 1:235817711-235817733 CAGGATGGAGGGTGGGAGAAGGG + Intronic
923826888 1:237510141-237510163 CTGGAGGCAGGAAGAGAGACAGG + Intronic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
924603233 1:245509848-245509870 CTGAAGGCAGGAAGGGAGAAGGG - Intronic
924727398 1:246683243-246683265 TTGGAGGCAGAAGGGGAGATGGG + Intergenic
924862271 1:247937016-247937038 CTGGTGGCCGGGTCGGTGATTGG - Intergenic
1063505722 10:6597630-6597652 CTGGAGGTGGGGGGGGAAATAGG - Intergenic
1063980254 10:11446656-11446678 AGGGAGGCAGGGAGGGAGGTAGG + Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1064011269 10:11738381-11738403 GTGGTGGTGGGGTGGGAGATGGG - Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064421741 10:15196723-15196745 AGGGAGGGAGGGAGGGAGATGGG - Intergenic
1064722571 10:18244910-18244932 TTGGAGTCAGAGAGGGAGATAGG + Intronic
1064817959 10:19288422-19288444 CAGGAGGCTGGGAGGGAGGTGGG - Intronic
1064932672 10:20644198-20644220 CAGGAGGCAGGGAAGGTGATTGG - Intergenic
1065022788 10:21514887-21514909 GTGGGGGCGGGGTGGGAGAAGGG - Exonic
1065462330 10:25982079-25982101 CTGCAGGCTGTGTGGGAGCTGGG + Intronic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066402773 10:35091329-35091351 CTGGAGGCAGGGTTTTAAATGGG - Intergenic
1067327205 10:45280975-45280997 CTGGGGGCAGGGTCGGAGGGGGG - Intergenic
1067343733 10:45423441-45423463 GAGGAGGCAGGGTGTGGGATGGG - Intronic
1067377942 10:45745108-45745130 TTGGTGGCAAGGTGGGAGAGAGG - Intronic
1067758079 10:49020766-49020788 AGGGAGGCAGGGAGGGAGAGAGG + Intronic
1067885642 10:50085784-50085806 TTGGTGGCAAGGTGGGAGAGAGG - Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069607890 10:69751573-69751595 CTGCAGGCAGGAAGGGAGAGGGG + Intergenic
1069737805 10:70669030-70669052 CTGGTGGCCTGCTGGGAGATGGG + Intergenic
1069773865 10:70915649-70915671 TAGGAGGCAGAGTGGGAGGTCGG - Intergenic
1069807522 10:71135143-71135165 AAGGAGGCAGTGTGGGAGAGGGG + Intergenic
1070182260 10:74025665-74025687 AGGGAGGCAGGGAGGGAGAGAGG + Intronic
1070761651 10:79027853-79027875 AGGCAGGCAGGGTGGGAGGTGGG - Intergenic
1070780592 10:79135458-79135480 CTGGTGGCTTGGTGGGAAATGGG - Intronic
1070939666 10:80333284-80333306 CTGGAGGCTGGGAGGGATAGTGG + Intergenic
1071274316 10:84038938-84038960 CCACAGGAAGGGTGGGAGATGGG + Intergenic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1072245855 10:93543200-93543222 CTGCAGGCAGGATGGCAGAGAGG - Intergenic
1072297075 10:94019465-94019487 CTGGAAGCAGGGTGGGTGATGGG - Intronic
1072569760 10:96648236-96648258 CTGGAGGCAGGTGAGGAGGTGGG + Intronic
1072754740 10:98011787-98011809 AGGGAGGAAGGGAGGGAGATGGG + Intronic
1073116166 10:101093179-101093201 CTGGCCACAGGGAGGGAGATGGG + Intronic
1073463413 10:103679533-103679555 ATGGAGGAAGGGTGGGGGAGAGG + Intronic
1073615113 10:104986713-104986735 CTGAAGACAGGGAGAGAGATAGG + Intronic
1074339724 10:112615763-112615785 CATGGGGAAGGGTGGGAGATGGG + Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1075447960 10:122526863-122526885 CTGGGGGCTGGGTGGTGGATGGG - Intergenic
1075646342 10:124099350-124099372 CAGGAGCCAGGGAGGGAGACGGG - Intergenic
1075741448 10:124698762-124698784 CTGGATGGAGGGTGGGGAATGGG - Intronic
1076537234 10:131187504-131187526 CGGGAGTTGGGGTGGGAGATGGG - Intronic
1076572490 10:131441620-131441642 GTGGAGGCAGAGAGGGAGAGGGG + Intergenic
1076702081 10:132278653-132278675 CAGGAGGCTGGGCGGGAGAATGG + Intronic
1076725603 10:132411507-132411529 CAGGAAGCAGGGGTGGAGATGGG + Intronic
1076889104 10:133275324-133275346 CTGGAGGGAGGAACGGAGATGGG + Intronic
1076946686 10:133656472-133656494 GTGGGGGCAGGGTGGGTGAAGGG - Intergenic
1077233265 11:1468170-1468192 GCGGAGGCTGGGTGGAAGATTGG - Intergenic
1077308863 11:1879735-1879757 AGGGAGGCAGGCTGGGAGAGGGG + Intronic
1077366286 11:2162608-2162630 CTGAGGCCAGGGTGGGACATAGG - Intergenic
1077375976 11:2205324-2205346 CTGGAGGCTGGGAGGGAGGGAGG - Intergenic
1077375989 11:2205355-2205377 CTGGAGGCTGGGAGGGAGGGAGG - Intergenic
1077444783 11:2585861-2585883 CTGGAGGCAGGTGGGGAGGCAGG + Intronic
1077467462 11:2740210-2740232 CAGGAGGGAGGGTGGGGGATGGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077659543 11:4055289-4055311 CTGGAGCCAGGAAGGGAGCTGGG - Intronic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1078005075 11:7526536-7526558 CTGGAGTGAGGGTGGGAGGCTGG + Intronic
1079237385 11:18700127-18700149 CAGCAGACAGGCTGGGAGATGGG - Intronic
1079968080 11:27003323-27003345 CTGGAGGCAGAGAGGGAAAGAGG - Intergenic
1080003362 11:27376803-27376825 GTGGAAGCTGGTTGGGAGATGGG - Intronic
1080057097 11:27917528-27917550 CGGGAGGCAGAGTAGGAGAATGG + Intergenic
1080083747 11:28253612-28253634 GGGGAGGGAGGGTAGGAGATGGG - Intronic
1080771857 11:35349141-35349163 CTGGAGGCAGGGATGTAGATGGG + Intronic
1081710847 11:45214393-45214415 CTGGGGGCAGGATGGGAGGGTGG - Intronic
1081737026 11:45411368-45411390 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1081737031 11:45411380-45411402 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1081777465 11:45685334-45685356 CTGGAGACAGGGTGGGAGCAAGG - Intergenic
1082829416 11:57604428-57604450 CTGGAGTCATGGTGGGAGTGGGG + Intronic
1083627619 11:64079587-64079609 CTGGGCGTGGGGTGGGAGATGGG + Intronic
1083681595 11:64354144-64354166 CTGAGGGCAGGGAGGCAGATGGG + Exonic
1083763569 11:64831770-64831792 CTGGAGGCAGGAAGGGAGGGAGG - Intronic
1084162314 11:67356520-67356542 CTGGAGGCAGGTGGAGAGAGGGG + Intronic
1084309925 11:68311156-68311178 CTGGATGCAGGGTGGAAGAAGGG + Intergenic
1085119710 11:73959233-73959255 CTGGGGGCAGGGTGAGAGACTGG - Intronic
1086549878 11:88043367-88043389 ATGGAGGCAGGGAAGGAGATAGG + Intergenic
1086960090 11:92972543-92972565 GTGGAGGCAAGGTGGGAGGTAGG + Intronic
1087405802 11:97728462-97728484 TGGGAGGAAGGGTGGGAGAGGGG + Intergenic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1088031957 11:105262087-105262109 CTGGAGGGAGGGAGGGAGAGAGG + Intergenic
1088457366 11:110047154-110047176 CAGGAGGCAGGCAGGCAGATGGG - Intergenic
1088678695 11:112221050-112221072 CTTGGGGCAGGGTGGGAGTAGGG + Intronic
1089158953 11:116423295-116423317 ATGCAGGCGGGGAGGGAGATGGG + Intergenic
1089223003 11:116890839-116890861 CTGGTGGGAGAGTGGGAGCTGGG + Intronic
1089294279 11:117458665-117458687 CAGGAGGCAGGGTGAGAGCAGGG - Intronic
1089653880 11:119933096-119933118 CGGGAAGCTGGCTGGGAGATGGG - Intergenic
1089895933 11:121929910-121929932 CTTGAGGGAGGGTGGGAGCGGGG + Intergenic
1089935410 11:122359356-122359378 CTGGAGGGAGGGAGGGAGGGAGG - Intergenic
1090257621 11:125296530-125296552 CAGGAGTCAGGGAGGGAGAGGGG - Intronic
1090366510 11:126211321-126211343 CCGGACGCAAGGTGGGAGAATGG - Intronic
1090743736 11:129690870-129690892 CAGGGGGCCGGGTGGGAAATGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091178085 11:133579611-133579633 CGGGAGCCAGGGTGGGCGAGGGG - Intergenic
1091357582 11:134949475-134949497 CTGGAGGCAGCTTGGCAGCTGGG + Intergenic
1091840093 12:3614626-3614648 CTGGAGTCAGGGTTGTAGGTGGG + Intronic
1091917308 12:4278931-4278953 CTTGAGCCGGGGAGGGAGATGGG + Intronic
1091964729 12:4729432-4729454 CAGGAGCCAGGGTGGGGGCTGGG - Intronic
1092057953 12:5522887-5522909 ATGGAAGCAGGGCTGGAGATGGG - Intergenic
1092164793 12:6336228-6336250 CTGGAGGGAGGGAGGGAGAGAGG + Intronic
1092171186 12:6374956-6374978 GTGGGCGCAGGGTGGGACATGGG - Exonic
1092618486 12:10237223-10237245 ATGGGGGCAGGGTGGGCCATAGG - Intergenic
1093767547 12:22982340-22982362 ATGGGGGCAGGGTGGGCCATGGG - Intergenic
1094213581 12:27917982-27918004 CTGGGGGGAGGGGAGGAGATAGG + Intergenic
1095370851 12:41465698-41465720 CTGGAGGAAGGGAGAGAGACTGG - Intronic
1095382989 12:41616819-41616841 CTGGAAGCAGGGCCTGAGATGGG + Intergenic
1095629505 12:44358163-44358185 CTAGAGGCAGGGAGGGAGGGAGG + Intronic
1095987775 12:48010907-48010929 CTGGAGGCTGGAGTGGAGATCGG - Intergenic
1096344806 12:50836438-50836460 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1096428020 12:51520743-51520765 CTGGGAGCAGGATGAGAGATGGG + Intergenic
1096616684 12:52837055-52837077 TTGGAAGCAGGGAGGGAGCTGGG - Intergenic
1096798886 12:54096380-54096402 CTGGGGGCAGGGGTAGAGATGGG - Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097801336 12:63917781-63917803 CAGAAAGCAGGGTGGGAAATTGG - Intronic
1098150441 12:67541021-67541043 CTGAGGGCAGGGTAGGGGATAGG - Intergenic
1098861976 12:75720484-75720506 CTTGGGGCAGGGTGGGGGAATGG + Intergenic
1100244082 12:92739077-92739099 TGGAAGGCAGGGTGAGAGATGGG - Intronic
1100644232 12:96511989-96512011 CTGGAGGGAGGGTTGAAGAGAGG - Intronic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1101440734 12:104702695-104702717 CTGGGGGCAGGGTGGAATCTGGG - Intronic
1102444692 12:112992838-112992860 CTGGAGTCAAGGAGGGAGACAGG + Intronic
1102654455 12:114469771-114469793 CTGAAGGCAGGCTGGGAGTGTGG - Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103957031 12:124582942-124582964 CTGGAGCCAGGGTGGGGGTGGGG + Intergenic
1104205490 12:126634650-126634672 CAGGAGGCAGGGAGGGGAATAGG - Intergenic
1104797773 12:131531618-131531640 ATGGAGGCAGGGTGTGAGTGTGG - Intergenic
1104834185 12:131776692-131776714 CTGGGGGCAGCCTGGGAGACTGG + Intronic
1104984148 12:132587216-132587238 CTGGAGGGAGGGTGGCAGTGCGG + Intergenic
1105334224 13:19449891-19449913 GAGGAGGAAGGGTAGGAGATAGG - Intronic
1105576690 13:21659898-21659920 CTGGACTCAGAGAGGGAGATGGG + Intergenic
1105860701 13:24409463-24409485 GAGGAGGAAGGGTGGGAGATAGG + Intergenic
1106454892 13:29918574-29918596 CTGAAGTCAGGTTTGGAGATGGG - Intergenic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1106760508 13:32862937-32862959 GTGGAGACAAAGTGGGAGATTGG + Intergenic
1107331433 13:39305397-39305419 TTGGAGGCTGGATGGGAGAATGG + Intergenic
1107488371 13:40854476-40854498 GAGGAGGAAGGGTAGGAGATAGG - Intergenic
1107549028 13:41457932-41457954 GTGGAGGGAAGGTGGGACATGGG - Intronic
1107610439 13:42107535-42107557 CTGGAGGGAGGGAGGGAGTATGG + Intronic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1108433373 13:50377198-50377220 TGGGAGGCAGGGTGGCTGATAGG + Intronic
1109585847 13:64402704-64402726 TGGCAGGCAGGGTGGGAGAAGGG - Intergenic
1109686318 13:65824693-65824715 TAGGTGGCAGGGTGGGAGGTGGG - Intergenic
1110463436 13:75773266-75773288 TTGGAGGCAGGATGAGAGGTAGG + Intronic
1110778995 13:79442332-79442354 CTAGAAGCAGAGTGTGAGATGGG - Intergenic
1111529800 13:89521938-89521960 CTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1112111906 13:96310620-96310642 AAGGAGGGAGGGAGGGAGATAGG - Intronic
1112162767 13:96886321-96886343 CTGGGGGAAGGGAGAGAGATGGG + Intergenic
1112294067 13:98171089-98171111 CTGGAAGCAGGATGGAAGAAGGG + Intronic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1112601572 13:100860722-100860744 CTGGGGGCAGGGGAGGAAATGGG - Intergenic
1112680801 13:101762951-101762973 CTGGAGGCAGGGTGTGTGTTTGG - Intronic
1113580733 13:111426791-111426813 CTGGAGCCAGGCAGGGAGAGGGG - Intergenic
1113611154 13:111645791-111645813 CAGGAGGCGGGGTGGGGGAGAGG + Intronic
1113663060 13:112120173-112120195 TGGGAGGCAGGGTGGGAGGCAGG + Intergenic
1113677111 13:112214896-112214918 CTGGAGGGGAGGAGGGAGATGGG + Intergenic
1113789787 13:113022224-113022246 GTGGAGGCAGCCTGGGAGCTTGG - Intronic
1113789796 13:113022266-113022288 GTGGAGGCAGCCTGGGAGCTTGG - Intronic
1114455562 14:22851200-22851222 CTGGTGGCAGGGTAGGACAGAGG - Intergenic
1114617167 14:24074468-24074490 CTGCAAGGAGGGTGGGGGATGGG - Intronic
1114754372 14:25242734-25242756 GAGGAGGGAGGGTGGGAGAAGGG + Intergenic
1115784493 14:36808898-36808920 GAGGAGGCAGAGTGGTAGATGGG + Intronic
1116190067 14:41653715-41653737 AGGGAGGCAGGATGGGAGATAGG + Intronic
1116674253 14:47885191-47885213 CAGGAGGAAGGGTGGGAGGCAGG - Intergenic
1116726303 14:48565330-48565352 CTGGAGGCGGGGAGGGGGCTTGG + Intergenic
1116799579 14:49429131-49429153 CTAGAAGCATGGTGGGGGATGGG - Intergenic
1117480135 14:56134870-56134892 CTGAAGTCAGGTTGGGAAATTGG - Intronic
1118884289 14:69853574-69853596 CTGGAGGCAGGGTGTGGGGTGGG + Intergenic
1119505968 14:75173350-75173372 CTGGAGGGAGGGAGGGAGAGAGG + Intronic
1119658498 14:76434303-76434325 CTGGAAGCAGAGGGGGAGAGAGG - Intronic
1119859390 14:77925367-77925389 CTGGCGGCAGGGTGAGGGCTTGG + Intronic
1119877075 14:78069962-78069984 CGGGAGGCAGGGTGGCAGCATGG + Intergenic
1120777400 14:88452688-88452710 CTGGAGGGAAGATGGTAGATAGG - Intronic
1122048381 14:99039273-99039295 CTGGGGGGTGGGTAGGAGATGGG - Intergenic
1122388217 14:101363100-101363122 CTGGGGGCAGGGTAGGGGAGCGG - Intergenic
1122524188 14:102368845-102368867 CTTGAGGGAGGCTTGGAGATAGG + Intronic
1123014376 14:105366786-105366808 GTGGAGGCAGGGTTGGAGCAGGG + Intronic
1123123081 14:105927052-105927074 CTGGAGGCTCTGAGGGAGATGGG + Intronic
1202920769 14_KI270723v1_random:29026-29048 GTGGGGGCAGGGTGGGTGAAGGG - Intergenic
1202924147 14_KI270724v1_random:8555-8577 GTGGGGGCAGGGTGGGTGAAGGG + Intergenic
1123405719 15:20018470-20018492 CTGGAGGCTCTGAGGGAGATGGG + Intergenic
1123515049 15:21025118-21025140 CTGGAGGCTCTGAGGGAGATGGG + Intergenic
1124401950 15:29356409-29356431 CGGGAGGCGAGGTGGGAGAATGG - Intronic
1124682090 15:31740430-31740452 GTGGGGGGAGGGTGGGAGGTGGG + Intronic
1124959440 15:34383587-34383609 GTGGGGGCAGAGAGGGAGATGGG - Intronic
1124976066 15:34529808-34529830 GTGGGGGCAGAGAGGGAGATGGG - Intronic
1125313954 15:38410926-38410948 CTTGAACTAGGGTGGGAGATTGG + Intergenic
1125361890 15:38873195-38873217 CTGGAGGCAGTGGGGAAGAAGGG - Intergenic
1125378306 15:39058113-39058135 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1127721676 15:61707969-61707991 CAGGAAGCAGGGTGGGTGTTGGG + Intergenic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1128364664 15:66989567-66989589 GAGGAGGCAGAGAGGGAGATAGG + Intergenic
1128428892 15:67572246-67572268 CGGGGGAGAGGGTGGGAGATGGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128728030 15:70002244-70002266 AGGGAGGCAGTGTGGGACATGGG - Intergenic
1128745419 15:70110920-70110942 CTGGAGGCAGGATGGGGCATAGG - Intergenic
1128752906 15:70161752-70161774 CTGGAGGCAGGGGTGCAGAGGGG - Intergenic
1128776642 15:70325352-70325374 CTAGAGGATGGGTGGTAGATAGG - Intergenic
1129065494 15:72900586-72900608 CTGCAGGCAGAGTCTGAGATAGG - Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129227894 15:74180413-74180435 CTGGAAGCTGGGTGGGACAAGGG + Intronic
1129454148 15:75667559-75667581 CCTAAGGCAGGGTGGGAGGTGGG - Intergenic
1129515313 15:76153660-76153682 CTGGAGGCTGGGTGTGAACTTGG + Intronic
1129663658 15:77567252-77567274 CAGCAGGCAGGCTGGGAGTTGGG + Intergenic
1129688627 15:77700609-77700631 CTGCAGGCGGGGTGGTAGGTGGG + Intronic
1130869790 15:87961562-87961584 CAGGAGCTGGGGTGGGAGATGGG + Intronic
1131084708 15:89566619-89566641 GCTGAGGAAGGGTGGGAGATGGG - Intergenic
1131260366 15:90884564-90884586 CTGGAGGAGCGGTGGGAGCTGGG + Intronic
1131369340 15:91866868-91866890 ATTGGGCCAGGGTGGGAGATGGG + Intronic
1131557146 15:93409617-93409639 CTGAAAGTAGGGTGGGAGATTGG - Intergenic
1132237362 15:100232283-100232305 ATGGAGCCAGGGTGGGAGGTGGG + Intronic
1132243125 15:100276046-100276068 CTGGTGGGAGGGTGGGAGGGAGG + Intronic
1132556949 16:576731-576753 ATGCAGGGAAGGTGGGAGATGGG - Intronic
1132875391 16:2134928-2134950 GTAGGGGCAGGGTGGGAGGTGGG - Intronic
1132986122 16:2768605-2768627 CTGGAGGCAGGGAGAGGGATGGG - Intronic
1133326869 16:4947245-4947267 ATGGAGGAAGGGAGGGAGAGAGG - Intronic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1133816979 16:9204991-9205013 CTAGAGGCAGAGTCTGAGATGGG - Intergenic
1134393718 16:13843283-13843305 ATGGCTGCAGGGAGGGAGATGGG - Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134519593 16:14912432-14912454 GTAGGGGCAGGGTGGGAGGTGGG + Intronic
1134554338 16:15153803-15153825 GTAGGGGCAGGGTGGGAGGTGGG - Intergenic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134605859 16:15570692-15570714 CTGTAGGCAGGGTAGCAGCTTGG + Intronic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134707265 16:16311088-16311110 GTAGGGGCAGGGTGGGAGGTGGG + Intergenic
1134960276 16:18401037-18401059 GTAGGGGCAGGGTGGGAGGTGGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135269596 16:21057668-21057690 CTGAAGGCAGGACGGGAGGTGGG + Intronic
1135595294 16:23737646-23737668 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1136002455 16:27305173-27305195 TTGGAGGCAGAAGGGGAGATGGG - Intergenic
1136037201 16:27549585-27549607 CTGGGGGCAGGGCGGGGGAATGG - Intronic
1136316066 16:29455249-29455271 CTGGAGGCAGGGCCTGAGGTGGG + Intronic
1136430643 16:30194591-30194613 CTGGAGGCAGGGCCTGAGGTGGG + Exonic
1136523345 16:30811908-30811930 GTGGTGGCTGAGTGGGAGATGGG + Intergenic
1136576270 16:31127166-31127188 CTGCAGGCAGGGTGGGAGTGAGG - Intronic
1137376516 16:47956414-47956436 GTGGATGCAGAGTGTGAGATAGG - Intergenic
1137676657 16:50306986-50307008 CTGGAGGCAGGGTGGGCAAGTGG + Intronic
1138100286 16:54246699-54246721 CTGGAGGCAGAGTGGGCCATGGG + Intronic
1138332650 16:56227398-56227420 CTGGAGACAGGGTGGGAACCAGG - Intronic
1138370032 16:56519645-56519667 CTGGGGGCGGGGTCGGAGAGGGG + Intronic
1138416806 16:56876357-56876379 CTAGAGGCAGGGTGGGAGGCTGG + Intronic
1139246786 16:65452391-65452413 GGGGAGGGAGGGAGGGAGATAGG + Intergenic
1139303094 16:65961930-65961952 AGGGAGGCAGGGAGGGAGAGAGG + Intergenic
1139341276 16:66269786-66269808 CTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1139527127 16:67523915-67523937 CGGGAGGCAAGGTGGGAGGATGG - Intronic
1139700411 16:68704582-68704604 CTGCAGGGAGGGAGGGAGAGAGG + Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1139949202 16:70660990-70661012 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1140166539 16:72558276-72558298 CTGGGGGCAGCGGGGGAGACTGG + Intergenic
1140200250 16:72889057-72889079 GTGGAGGGAGGGAGGGAGGTGGG + Intronic
1140481163 16:75263626-75263648 GGGGAAGCAGGGTGAGAGATTGG - Intronic
1140598284 16:76442145-76442167 TAGGAGGCAGGGAGGGAGAGAGG + Intronic
1141094018 16:81149890-81149912 CTGCAGGCAGGCAGGGAGAGAGG + Intergenic
1141103726 16:81216186-81216208 CTGCAGGCAGGCAGGGAGACAGG + Intergenic
1141103731 16:81216198-81216220 AGGGAGACAGGGTGGGAGATGGG + Intergenic
1141517267 16:84553941-84553963 CTGGAGGCAGGTGCGGAGGTAGG - Intronic
1141517479 16:84555529-84555551 GTGGAGCCAGGGTGGGAGGCGGG + Intergenic
1141670837 16:85491005-85491027 CCAGAGGCAGGGGGAGAGATCGG - Intergenic
1141704029 16:85654969-85654991 CTGAAGGCCGGGTGGGGGAAGGG - Exonic
1141737102 16:85861033-85861055 ATGGAGGCAGGCTGGAAGGTTGG + Intergenic
1141952011 16:87345329-87345351 CGGGAGGCAGGGTGGGAGGGAGG + Intronic
1141973067 16:87495778-87495800 ATGGGGGAGGGGTGGGAGATGGG - Intergenic
1141973079 16:87495802-87495824 GTGGGGGGGGGGTGGGAGATGGG - Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142218750 16:88842569-88842591 CTGCAGGGAGGGTGGCAGGTGGG - Intronic
1142399705 16:89852508-89852530 GTGGAGGGAGGATGGAAGATGGG - Intronic
1142399738 16:89852586-89852608 GTGGAGGGAGGATGGAAGATGGG - Intronic
1142418190 16:89954388-89954410 TGGGAGTCAGGGTGGGAGCTGGG + Intronic
1142851768 17:2707880-2707902 CTGGTGGAAGGGAGGGGGATGGG + Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143181491 17:4986954-4986976 CTGGAGCCAGAGCGGTAGATGGG - Exonic
1143300068 17:5902401-5902423 CAGGAGGCAGGCAGGGAGCTGGG + Intronic
1143344363 17:6239212-6239234 CTGCAGGCTGGGTGGGGGACAGG + Intergenic
1143444399 17:6998827-6998849 CTGAAGGCAGGGTGAGAAAAAGG + Exonic
1143516421 17:7421389-7421411 CTGGGCCCAGGGTGGGAGCTGGG - Exonic
1144579498 17:16450425-16450447 CTGGGGGCAGGGGTGGGGATGGG - Intronic
1144623840 17:16834454-16834476 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1144625046 17:16840215-16840237 GGGGAGGCAGGCTGGGTGATTGG - Intergenic
1144757131 17:17686480-17686502 GGGGAGGCAGGGTGGGAGGCAGG + Intronic
1144881384 17:18432506-18432528 GGGGAGGCAGGCTGGGTGATTGG + Intergenic
1144882591 17:18438262-18438284 CTGCAGGCATGGTGGGAGCCTGG + Intergenic
1145149643 17:20506124-20506146 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1145779290 17:27551768-27551790 CTGGAGGCAGGGAGGGAGAGAGG - Intronic
1146275191 17:31511946-31511968 CTGGGGACAGGGTGGGACAGTGG + Intronic
1146601941 17:34225013-34225035 CTTGAGGCAGTGTGGGGGTTGGG + Intergenic
1146643792 17:34562983-34563005 CTGGGGCCAGGGTGGAGGATAGG - Intergenic
1146916308 17:36680483-36680505 CTGGATGTGGGGTGGGAGAAGGG - Intergenic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1146943978 17:36861858-36861880 CTGCAGGCAGACTGGGAGCTGGG + Intergenic
1147056111 17:37836419-37836441 GTGGAGGCACGGTGGGAGGCAGG - Intergenic
1147176462 17:38659012-38659034 CTGGAGGCAGGGTGGGCGCGAGG + Intergenic
1147212574 17:38880467-38880489 CTGGAGGCCAGGAGGGAGACAGG - Intronic
1147335610 17:39725447-39725469 CTGGAGGGAGGATGAGAGCTGGG + Intronic
1147446126 17:40476218-40476240 CTGGAGGCTGGGTGGGGGTGGGG + Exonic
1147578130 17:41614158-41614180 CTGCAGGCATGGTGGGAGCCTGG - Intronic
1147671586 17:42179979-42180001 CTGGGGGCAGGGAGGCTGATGGG + Intronic
1147861136 17:43524243-43524265 CTGGAGACGGGGTGGGAAGTGGG - Exonic
1148126091 17:45237720-45237742 CTGGAGGCAGCTGGGGACATTGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148441141 17:47712080-47712102 CTGGGGGCAGGGCGGGGGACGGG + Intergenic
1148466143 17:47866391-47866413 CTGGAGACAAGGAGGAAGATGGG + Intergenic
1148582199 17:48751988-48752010 CTGAAGGAAGGGTGGGGGCTGGG + Intergenic
1148675361 17:49441755-49441777 CTGCAGGGAGGGAGGGAGAGGGG - Intronic
1148690844 17:49525997-49526019 CTGGCCGCAGGGAGGGAGACAGG - Intergenic
1148748469 17:49931361-49931383 ATGGAGGCAGGGGAGGAGAATGG - Intergenic
1148833991 17:50455742-50455764 CTGCTGGCTGGGTGGGTGATGGG - Intronic
1148860145 17:50600442-50600464 CTGGAGGCAGGGGTGGGGAGAGG + Intronic
1149467499 17:56891551-56891573 CTGGCGGGAGGGTGGGAGGTGGG - Exonic
1149557227 17:57582150-57582172 CTGGAGGTAGGGTGGGAACAGGG - Intronic
1149575236 17:57707270-57707292 CTGGAGGCTGGGAGGGAGATGGG - Intergenic
1150021647 17:61621203-61621225 ATGGTGGCAGGGAGGGAAATGGG - Intergenic
1150411002 17:64940571-64940593 CTGGAAGCAGCCTGGGAGATGGG - Intergenic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1150880124 17:69015062-69015084 CTGGAGGCAGAATGGAAGAATGG - Intronic
1151240064 17:72750420-72750442 CTGGAGGTGGGGTGGGGGGTGGG + Intronic
1151345219 17:73497300-73497322 CTAGAGGCTGGATGGGAGAGGGG - Intronic
1151347943 17:73514766-73514788 TTGGAAACAGGGTGGGAGCTGGG + Intronic
1151993234 17:77591963-77591985 GTGGAGGTGGGGTGGGAGTTGGG + Intergenic
1152285696 17:79411488-79411510 CTGGAGGGGAGGTGGGAGAAGGG - Intronic
1152399324 17:80055756-80055778 CTGGTGGCTGGGTGGGGGAAGGG - Intronic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1152800735 17:82329614-82329636 CTGGACGTATGATGGGAGATGGG - Intronic
1152984711 18:311222-311244 ATGGAGGAAGGGGGGGATATGGG + Intergenic
1153158762 18:2179455-2179477 CAGGGGGCAGGGTGGGCCATGGG - Intergenic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1153692644 18:7608833-7608855 CTGGGAGCAGGGTGGGGTATGGG + Intronic
1154466013 18:14643112-14643134 CTGGAGGCAGTGGGGCAGTTTGG + Intergenic
1155727081 18:29100079-29100101 CTGCAGACAAGATGGGAGATGGG - Intergenic
1156271716 18:35541045-35541067 CTGCAGGCAGGCTGGGTGAGGGG - Intergenic
1156326660 18:36079712-36079734 CTGCAGCCACTGTGGGAGATGGG - Intergenic
1156456141 18:37295529-37295551 CTGGAGGCAGGGAGGCATCTGGG + Intronic
1156474129 18:37394949-37394971 GTGGAGGCCGGGTGGGGGGTGGG - Intronic
1156660119 18:39336714-39336736 CAGCAGGCAGGGTGGGAGGTGGG - Intergenic
1156809854 18:41234552-41234574 CTAGAGGCAGTGAGGGACATTGG + Intergenic
1157305971 18:46518056-46518078 CTGAAGGCAGGGTGGGGCAGAGG + Intronic
1157337345 18:46751133-46751155 CTGGGGGCTGGGTGTGGGATGGG - Intronic
1158077297 18:53545440-53545462 CTGGAAGCTGGGTTGAAGATAGG - Intergenic
1160015991 18:75141181-75141203 ATGGAGGCAGAGAGAGAGATTGG + Intergenic
1160148871 18:76384597-76384619 CTGTAGGGGGGGTGGGGGATGGG - Intronic
1160333830 18:78018975-78018997 CTGGTGGTAGGGTGAGAGCTGGG + Intergenic
1160863278 19:1246549-1246571 CAAGAGGCAGGGAGGGAGGTGGG + Intergenic
1160920675 19:1518815-1518837 CAGGGAGCAGGGTGGGAGCTGGG - Intergenic
1161153977 19:2722832-2722854 CTGGGGTCAGGGTGGGAGGGAGG - Intronic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161583691 19:5093979-5094001 CTGGAGGCAGAGGCTGAGATGGG + Intronic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162395568 19:10416613-10416635 CGGGAGGAAGGGTGGGGGCTGGG + Intronic
1162483121 19:10941061-10941083 AGGGAGGCAGGGAGGGAGAGAGG + Intergenic
1162490307 19:10987534-10987556 CTGGGTGAAAGGTGGGAGATGGG + Intronic
1163121880 19:15223288-15223310 CTGGAGGCAGGGAGAGGGACAGG + Intergenic
1163427633 19:17247899-17247921 CTGAGAGCTGGGTGGGAGATGGG + Intronic
1164471248 19:28535572-28535594 CTGGAGGGAGGGTTGAATATGGG - Intergenic
1164553662 19:29233327-29233349 CGGGAGGCAAGGTGGGAGGATGG - Intergenic
1164731047 19:30504565-30504587 AAGGAGGAAGGGTGGGAGAGAGG - Intronic
1164731057 19:30504605-30504627 AGGGAGGAAGGGTGGGAGAGAGG - Intronic
1164743523 19:30594474-30594496 CTGGAGGGAGGTAGGGAGAAAGG - Intronic
1164887597 19:31795686-31795708 CTGGAGGCAGGTTGGGGCATGGG - Intergenic
1165235926 19:34421572-34421594 CTGGCTGCAGGCTGGGAGCTCGG - Exonic
1165317004 19:35062186-35062208 ATGGTGGCAGGGTGGGAGGTGGG + Intronic
1165930252 19:39353190-39353212 CTGGATGCAGGGTGGATGAGTGG - Intronic
1165943693 19:39428646-39428668 GAGGAGGCAGGGAGGGAGAAGGG + Intergenic
1166072628 19:40395783-40395805 CTGAAGGCAGAGTGAGAGAGGGG + Exonic
1166219884 19:41357564-41357586 CGGGAGGCAGGGTCTGAGAGAGG - Intronic
1166299261 19:41904926-41904948 CTGCAGGGAGAGGGGGAGATGGG - Intronic
1166473508 19:43100388-43100410 CTGGAGGGAGGGAGAGAGAGAGG + Intronic
1166739132 19:45103626-45103648 AGGGAGGGAGGGTGGGAGAGTGG + Intronic
1166761674 19:45228135-45228157 GTGGAGGGAGGCTGGGGGATGGG - Intronic
1167213623 19:48149496-48149518 CTGGAGGCAGGGTCAGAGGGTGG + Intronic
1167322547 19:48805840-48805862 GGGGAGGCATGGTGGGAGAGGGG - Intronic
1168058478 19:53877033-53877055 CTGGAGCCAGGGTGGGATGGAGG - Intergenic
1168406477 19:56112993-56113015 CAAGAGGCAGGGTGGGAGCCAGG - Intronic
925017698 2:543952-543974 CTGGAGGCAGGGAGGCAGGGAGG + Intergenic
925191668 2:1889715-1889737 ATGGAGGGAGGGAGGGAGAGAGG - Intronic
925322517 2:2985435-2985457 GAGGAGGGAGGGTGGGAGAAGGG + Intergenic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
926008093 2:9388473-9388495 CTGCAGGCTGGGCGGGAGGTGGG - Exonic
926043232 2:9691490-9691512 ATGGTGGGAGGGAGGGAGATGGG - Intergenic
926071578 2:9897975-9897997 CTGGGGGCGGGGTGGGGGGTTGG - Intronic
926162967 2:10501324-10501346 CTGGAGTCTGGGTGGGGAATTGG + Intergenic
926219462 2:10925349-10925371 CTGGAGCCAGGGTGGGATTTGGG + Intergenic
926316819 2:11715988-11716010 CTGGAGGCAGGGGGGCAGCTTGG + Intronic
926633199 2:15156271-15156293 CTAGAAGCAGGTGGGGAGATGGG + Intergenic
926663164 2:15491172-15491194 ATGGAGGAAGGGTGGGAGGAAGG - Intronic
927204670 2:20599504-20599526 CTGGAGGCAGGCTGGGATTGTGG + Intronic
927220393 2:20702774-20702796 ATGGAGGCAGGATGGGAGGAAGG - Intronic
927576720 2:24207222-24207244 CTGCAGCCTGGGTGGGAGATCGG + Intronic
927606156 2:24489314-24489336 CGGGCTGCAGAGTGGGAGATTGG + Intergenic
928631170 2:33193845-33193867 CTGAAGACAGGGAGAGAGATGGG - Intronic
928737447 2:34308662-34308684 ATGGAGGCAGGGTGGGAGAAAGG - Intergenic
928942697 2:36742597-36742619 CTGGTGGGAGGATGGTAGATTGG - Intronic
929370227 2:41214476-41214498 CAGGGGGAAGGGTGGGAGAGTGG - Intergenic
929572284 2:43030186-43030208 CTGGAGGTAAGGTGGGAGTGGGG - Intergenic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
929858629 2:45656016-45656038 CTGTAGTCAGGGTTGGAGAATGG + Intronic
930599577 2:53427680-53427702 CTGTAGGCAGAATGTGAGATTGG - Intergenic
930837316 2:55808105-55808127 CTGGATGCTGGGTGGGGGAGTGG - Intergenic
931665180 2:64605366-64605388 CCGGAGCCAGGGTGGAAGCTGGG + Intergenic
932410079 2:71542022-71542044 CTGAAGGCAGAGTGGGGGAGTGG + Intronic
933103675 2:78293472-78293494 AGGGAGGCAGGGAGGTAGATAGG - Intergenic
933540419 2:83634097-83634119 GAGGAGGGAGGGTGGGAGAAGGG + Intergenic
933678305 2:85077135-85077157 ATGGAGGCAGGGGCTGAGATGGG + Intergenic
933739874 2:85525134-85525156 GTGGGGGCAGGGTGGGGGAAAGG - Intergenic
933804513 2:85988493-85988515 CTGGAGCACAGGTGGGAGATGGG - Intergenic
934909819 2:98241430-98241452 CAGGAGGCAGTTGGGGAGATGGG + Intronic
935217020 2:100982546-100982568 CTGGAGGCAGGGATGGGGACCGG - Intronic
935697952 2:105786365-105786387 CTGGGGACAGGATGGGAGTTCGG + Intronic
935717646 2:105953017-105953039 AGGGAGGCAGTGTGGGAGTTGGG + Intergenic
936079762 2:109424098-109424120 CTGGAGGCAGGCCCTGAGATGGG + Intronic
936229040 2:110683299-110683321 CTGGAGACAGGGAGAGAGATGGG + Intergenic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936471098 2:112799313-112799335 TGGGAGGGAGGGTGGGAGAATGG + Intergenic
936913478 2:117615995-117616017 CTGAAGCCAGGGTGGGCGTTGGG - Intergenic
937116231 2:119406913-119406935 CCAGAGGCTGTGTGGGAGATGGG + Intergenic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
938218984 2:129549444-129549466 CTGGAGGCAGGGGAGGAGTTAGG - Intergenic
938938634 2:136149224-136149246 ATGGAGGCTGGGAGGGAGACAGG + Intergenic
939450796 2:142371677-142371699 GTGGGGGCAGAGTGGCAGATTGG + Intergenic
939631788 2:144534441-144534463 GGGGATGCAGGGTGGGAGGTTGG - Intergenic
939696786 2:145335698-145335720 CTGGAGGCCGTGTGGGTGCTAGG + Intergenic
939789263 2:146551020-146551042 CTGAAACAAGGGTGGGAGATGGG - Intergenic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
940161560 2:150719493-150719515 ATGGTGGCATGGTGGGTGATGGG - Intergenic
940236182 2:151513053-151513075 TTGGATGCAGGATGGGATATGGG + Intronic
940333015 2:152495740-152495762 CTGGAGGCAGGCAGGCAGGTAGG - Intronic
940580920 2:155578945-155578967 CTAGAGGCAGGGAAGGAGAAGGG + Intergenic
940603763 2:155894029-155894051 CTGGAAGCAGGGAGAGAGAATGG - Intergenic
941045595 2:160671767-160671789 CTTGAGGGAAGGTGGGAGAGAGG + Intergenic
941262116 2:163310621-163310643 CTGGGGGCAGCGTGGGGGGTTGG - Intergenic
941859781 2:170267143-170267165 CTGGGGGTAGGGTGGGAATTGGG + Intronic
942051582 2:172145828-172145850 GTGGAGGCTGGGAGGGAGACAGG + Intergenic
942422460 2:175821934-175821956 CTTGTGTCAGAGTGGGAGATGGG - Intergenic
944116040 2:196187191-196187213 CAGGAGGTAGGGTGGGGGAAGGG - Intergenic
944148982 2:196537298-196537320 ATGGGGACAGGGTGGGAGGTGGG + Intronic
944366046 2:198920593-198920615 CTGGAGTTGGGGTTGGAGATAGG - Intergenic
944487303 2:200220681-200220703 CTTGAAGGAGGGTGGGAGAGGGG - Intergenic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946606259 2:221408688-221408710 AAGGAGGCAGGCTGGGAGATAGG - Intergenic
946646242 2:221837805-221837827 ATGGAAGCAGGTTGGGAGATAGG - Intergenic
946875035 2:224120382-224120404 ATGGAGGGAGGGTGGGAGGTGGG + Intergenic
946941071 2:224770743-224770765 TAGAAGGCAGGGTGTGAGATGGG - Intronic
946973657 2:225123238-225123260 CAGGAGGGAGGGAGGGAGAGAGG - Intergenic
947350137 2:229235080-229235102 CTAGAGAGAGGGTGGGAGAGAGG - Intronic
947610551 2:231522605-231522627 CTTGGGGGAGGGTGGGGGATAGG - Intergenic
947736820 2:232459477-232459499 ATAGAGGCAGGGTGGGGGTTGGG - Exonic
947826265 2:233107812-233107834 TTGGAGACAGGGTGGGTGCTTGG + Intronic
948046745 2:234951620-234951642 CCGGAGAAGGGGTGGGAGATGGG + Intergenic
948062501 2:235052060-235052082 CTGGAAGCAGTGGGGGAGAAGGG + Intronic
948272172 2:236683169-236683191 AGGGAGCCAGGGTGGGAGAGAGG + Intergenic
948368487 2:237473554-237473576 CTGCAGGCGGGGAGGGAGATGGG - Intergenic
948414472 2:237792458-237792480 CTGGAGGCAGGCTTGGGAATAGG - Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948863697 2:240764883-240764905 CTCGGGGCAGGGTGGGAACTTGG - Intronic
948870700 2:240796482-240796504 CAGGATGCACTGTGGGAGATTGG - Intronic
948878204 2:240841366-240841388 CTGCAAGGAGGCTGGGAGATGGG - Intergenic
1168845912 20:944615-944637 CTGGAGTGGGGGTGGGAAATGGG + Intergenic
1168883442 20:1226179-1226201 CTGTAGGCGGGCTGGGAGATGGG + Exonic
1169207610 20:3749049-3749071 TTGGATACAGGGTGGGAGTTTGG + Intronic
1169546098 20:6652572-6652594 CAGGAGTCAGGGTGGGATCTAGG - Intergenic
1170084584 20:12514638-12514660 CTAGAAGCAGGGTCTGAGATGGG + Intergenic
1170361171 20:15548072-15548094 ATGGAGGAAGGGAGGGGGATAGG - Intronic
1170866078 20:20159536-20159558 GTGGAGACAGGCAGGGAGATTGG - Intronic
1170867990 20:20177432-20177454 ATGGAGGGAGGGTGGAAGAAAGG - Intronic
1171049664 20:21843627-21843649 TTGGAGGCAGGGTGGGCAAAAGG + Intergenic
1171204288 20:23266972-23266994 CAGGAGGCAGGGTGGGTGGGAGG + Intergenic
1171463387 20:25311407-25311429 CTGGAATCAGGGTGGGAGCAGGG - Intronic
1171797533 20:29577970-29577992 CTGGGGGCAGGGGTAGAGATGGG + Intergenic
1171846667 20:30281579-30281601 TTTGAGGCAGCGTGGGAGAGGGG - Intergenic
1171850719 20:30306191-30306213 CTGGGGGCAGGGGTAGAGATGGG - Intergenic
1171964695 20:31520661-31520683 CTCATGGCAGGGTGGGTGATAGG + Intronic
1172022803 20:31926081-31926103 CAGGAGACAGGGTATGAGATAGG + Exonic
1172140449 20:32719224-32719246 CTGGAGTCTGGATGGGAGAATGG + Intronic
1172292176 20:33784234-33784256 ATGGAGAGAGGGAGGGAGATGGG - Intronic
1172394158 20:34587645-34587667 ATGCCGGCAGGGTGGGAGAATGG - Intronic
1172700734 20:36852267-36852289 CCAGAGCCAGGGTGGCAGATGGG - Intronic
1172859146 20:38033728-38033750 CTCGCGGCAGGGTGAGAGGTCGG + Exonic
1173672108 20:44805983-44806005 CTGGGGGCGGGGTGGGATAGTGG - Intronic
1173790476 20:45824703-45824725 CTCTAGGCAGGGTGGGGGTTGGG - Intronic
1173834860 20:46118501-46118523 CAGGAGGGTGGGTGGGAGCTGGG + Intronic
1174392624 20:50227150-50227172 CTGGAGCCAGGTTTGTAGATGGG + Intergenic
1175221215 20:57417548-57417570 ATGGAGGGAGGGAGGGTGATTGG + Intergenic
1175322653 20:58100311-58100333 CCGGGCTCAGGGTGGGAGATGGG - Intergenic
1175353058 20:58339955-58339977 CTGGATTCAGGGTGAGACATGGG - Intronic
1175706360 20:61180665-61180687 CTGGTGTCTGGGTGAGAGATAGG - Intergenic
1175845042 20:62053739-62053761 CTGGGGGCAGGGTGGGATACGGG - Intronic
1175962930 20:62646204-62646226 CAGGAGGCAGGGCGGGTGGTGGG - Intronic
1175984159 20:62755729-62755751 CTGGAGGGAGGGAGGGAGGGAGG - Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176093378 20:63328793-63328815 CGGGAGGAAGGATGGGAGGTAGG - Intronic
1176297969 21:5084542-5084564 CAGGAGGCAGGGTGGCAGCAAGG + Intergenic
1176298157 21:5085357-5085379 CTGGAGGCTGGAAGGCAGATCGG - Intergenic
1176738834 21:10578768-10578790 GAGGAGGAAGGGTAGGAGATAGG + Intronic
1176808573 21:13515484-13515506 CTGGAGGCAGTGGGGCAGTTTGG - Intergenic
1176964845 21:15200754-15200776 CAGGAGGGACGTTGGGAGATTGG + Intergenic
1177080444 21:16632735-16632757 TTAGAGGCAGGGAGGCAGATAGG + Intergenic
1177588348 21:23128618-23128640 CTGGAAGGAGGGAGGGAGGTAGG - Intergenic
1177661645 21:24091457-24091479 CAGGAGAAAGGGTGGGAGTTGGG + Intergenic
1178169157 21:30019405-30019427 CTGGAGGCAGGATGGTAGGGAGG + Intergenic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1178631370 21:34264226-34264248 CTGGCGGCAGGTGGGGAGAGAGG + Intergenic
1178913214 21:36692997-36693019 TGGGAGGGAGGATGGGAGATGGG + Intergenic
1179184836 21:39077379-39077401 CAAGGGTCAGGGTGGGAGATGGG - Intergenic
1179573492 21:42292101-42292123 CGGGGGGCAGGGTGGGCGATGGG - Intronic
1179858872 21:44176592-44176614 CTGGAGGCTGGAAGGCAGATCGG + Intergenic
1179859060 21:44177407-44177429 CAGGAGGCAGGGTGGCAGCAAGG - Intergenic
1179884328 21:44306997-44307019 CTGGGGGCAGGGAAGGAGCTGGG + Intronic
1180195420 21:46190939-46190961 CTGGAGGCAGGGATGGGGACAGG - Exonic
1180224835 21:46386202-46386224 CAGCAGGCAGGGTGGGAGGAGGG - Intronic
1180840550 22:18957001-18957023 CTGGAGGCAAGGTGGGCGTGGGG + Intergenic
1181029420 22:20142705-20142727 CTGCAGGCGGGGTGGCAGGTGGG + Intronic
1181060943 22:20281773-20281795 CTGGAGGCAAGGTGGGCGTGGGG - Intronic
1181111346 22:20604798-20604820 CTGGCGGGAGGGAGGGAGGTTGG - Intergenic
1181164190 22:20974638-20974660 TGAGGGGCAGGGTGGGAGATGGG + Intronic
1181513823 22:23400612-23400634 CTGCAGGCAGGGTAGCAGGTGGG - Intergenic
1181760397 22:25054454-25054476 GTGTATGCAGGGTGGGAGGTGGG + Intronic
1182100785 22:27655999-27656021 ATGGAGGAAGGGAGGGAGAGAGG + Intergenic
1182713655 22:32338479-32338501 GTGGAGACAGGGTGGGTGGTGGG - Intergenic
1182715507 22:32353955-32353977 CCGGAGGCAGGGAGTGAGTTGGG - Intergenic
1183077285 22:35435180-35435202 TGGGAGGCAGGGAGAGAGATGGG + Intergenic
1183596986 22:38818735-38818757 CGGGGGTCAGGGTGGGAGGTGGG + Exonic
1183625336 22:38998021-38998043 AGGGAGGGAGGGAGGGAGATAGG - Intergenic
1183698327 22:39435830-39435852 CTTGGGGCAGGCTGGAAGATGGG - Intronic
1183935034 22:41257112-41257134 CTGGACAGAGGGTGGGGGATGGG - Intronic
1184421198 22:44383860-44383882 CTGGAGGGAGGGAGGGAGAGAGG + Intergenic
1184852373 22:47128127-47128149 GTGGAGGGAGGATGGGGGATGGG - Intronic
1184852386 22:47128154-47128176 GTGGAGGGAGGATGGGGGATGGG - Intronic
1185041357 22:48506104-48506126 CTGGAGACAGGGAGTGAGATAGG - Intronic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1185326105 22:50226569-50226591 GTGGGGGCAGGGTGGGGGGTTGG + Intronic
949520103 3:4843731-4843753 ACGGAGGGAGGGTGGGCGATGGG + Intronic
949538452 3:5013561-5013583 ATGGAGGGAGGGAGGGAGACAGG - Intergenic
949675472 3:6448070-6448092 CGGGGGGCAGGGTGGGCCATAGG + Intergenic
949840099 3:8311112-8311134 GTGGGGGGAAGGTGGGAGATGGG - Intergenic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950544061 3:13628649-13628671 CTGGAGGCAGGGCGGGATCGAGG - Intronic
950725064 3:14911945-14911967 CTGGAGGAAGGATGGGAGTTTGG + Intronic
950905068 3:16530627-16530649 CTGGAGGCAGGGGGTGGGTTTGG - Intergenic
951859657 3:27237645-27237667 CAGGAGGAAGGGTGGGAGTGGGG + Intronic
952598186 3:35044375-35044397 ACGGGGGCAGGGTGGCAGATGGG - Intergenic
953045937 3:39294278-39294300 CAGGAGGCCAGGTGGGTGATGGG + Intergenic
953312381 3:41891340-41891362 CTGGAGGGAGGGAGGGAGGGAGG + Intronic
953395151 3:42563287-42563309 CTGGGGGCAGGGTGGAGGAAGGG - Intronic
954049582 3:47962436-47962458 TTGGGGGCAGGGTGGGGGAGGGG + Intronic
954296073 3:49675063-49675085 CTGGAGACAGATTGAGAGATTGG + Intronic
954467560 3:50665374-50665396 GTGGGGGCAGGGTGGCAGGTGGG - Intergenic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954602046 3:51877735-51877757 CTAGAAGCAGGGTGGGTGCTGGG + Intergenic
954607945 3:51928583-51928605 CTAGAGGCAGGGTGAGCGCTGGG + Intergenic
954641077 3:52098250-52098272 CTGGAGGAAGGGTGTGAGCAGGG + Intronic
954993738 3:54863402-54863424 CTGAAAGCAGGGAGGGAGAGTGG - Intronic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955219120 3:57009314-57009336 TTGCAGGCAGGCTGGGGGATAGG - Intronic
955230501 3:57095036-57095058 CCTGAGGCAAGGTGGGAGGTGGG - Exonic
955805880 3:62733838-62733860 CTGGAGGAAGGGTAGGAGTTGGG - Intronic
955948674 3:64220417-64220439 CTCGAGGCAGGCTGGGTGCTGGG + Intronic
956305656 3:67821590-67821612 CTGGAGGCAGAGGGGTAGAGGGG - Intergenic
957080770 3:75633938-75633960 GTGGGGGCAGGGTGGGTGAAGGG + Intergenic
957366991 3:79238303-79238325 TTGGAGGCAGGATGGGATAGCGG - Intronic
957404803 3:79763706-79763728 ATACAGGCAGGGTGGCAGATAGG + Intronic
958019444 3:87979130-87979152 AGGGAGGGAGGGAGGGAGATGGG + Intergenic
958944702 3:100350190-100350212 CTGGTTGCATGGTGGAAGATGGG + Intronic
959619563 3:108385534-108385556 CTAGAGGCAGGCAGGTAGATAGG + Intronic
960129943 3:114045171-114045193 CTACTGGCAGGGTGGGAGGTGGG + Intronic
960459967 3:117921614-117921636 GAGGAGGCAGTGTGGGAGGTAGG - Intergenic
960732793 3:120744725-120744747 GTGGAGGCAGTGTGGAATATTGG - Intronic
960750636 3:120948550-120948572 CAGGAGGAAGGGTGGGAGTTGGG - Intronic
961582706 3:127895572-127895594 CTGCAGGAGGGGTGGGCGATGGG + Intergenic
961957504 3:130819165-130819187 CAGGATGCAGGGTGGGGGCTGGG - Intergenic
962361648 3:134748114-134748136 GTGGGGGTAGGGTGGGAGTTAGG + Intronic
962975185 3:140440072-140440094 GTGGAGGCTGGGGTGGAGATTGG + Intronic
963063260 3:141241855-141241877 CTGGAGGCTGAGTAGGAGAGGGG + Intronic
963106116 3:141648666-141648688 CTGCAGGGAGGCTGGGAGCTTGG + Intergenic
963253232 3:143120589-143120611 GAGGAGGCTGGGAGGGAGATTGG + Intronic
963347775 3:144116361-144116383 CTGGAAGCAGAGTGGCTGATTGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966559355 3:181302230-181302252 CTGGAGGGAGGGAGTGAGATGGG + Intergenic
967329967 3:188280558-188280580 TTGGGGGCGGGGTGGGGGATGGG - Intronic
968471250 4:783423-783445 CTGGATGCCAGGTGGGAGCTGGG - Intergenic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
968903173 4:3440599-3440621 GTGGAGGCATGGTGGGTGCTGGG - Intergenic
968903209 4:3440688-3440710 GTGGAGGCATGGTGGGTGCTGGG - Intergenic
969039849 4:4287688-4287710 ATGGAGGCAGGGTGGGAGCCTGG - Intronic
969239311 4:5888610-5888632 CGGGGGGCGGGGTGGGAGATCGG - Intronic
969396975 4:6928228-6928250 CTTGTGGCAGGCTGGGAGGTGGG + Intronic
969431791 4:7159418-7159440 GTGGGGGCAGGGTGGGAGTGGGG - Intergenic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
969515104 4:7643064-7643086 CTGGAGGCAGGGCGGGCGTATGG - Intronic
969566144 4:7979363-7979385 CCTGCGGGAGGGTGGGAGATGGG - Intronic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970619416 4:17801995-17802017 CGGGAGGCAGGGCAGGAGAATGG + Exonic
970859272 4:20683156-20683178 CTGGAAGCAGACTGGGAGGTAGG - Intergenic
971413292 4:26398275-26398297 GTGGAGGGAGTGTGGGAGAGAGG - Intronic
972555307 4:40175388-40175410 CCTGGGGCAGGGTGGGAGGTAGG + Intergenic
972808942 4:42561809-42561831 ATGGAGGCAGAGCGGGAGCTAGG - Intronic
972929616 4:44055582-44055604 CTGAAGGCAGGCTGGGAGGAAGG + Intergenic
972934016 4:44109074-44109096 CTAGAGGCTGGGAGGGATATTGG - Intergenic
974292790 4:59955184-59955206 CTGGAGGCAGGGGGGGATTTGGG + Intergenic
974468601 4:62290673-62290695 CTGGGGGTAGAGTGGGAGGTAGG + Intergenic
974801757 4:66827765-66827787 GTGGGGGCGGGGTGGGGGATAGG + Intergenic
975623812 4:76321999-76322021 TTGGGGGAAGGGTGGGAGGTGGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976663514 4:87565290-87565312 AGGGAGGCAGGGTATGAGATAGG + Intergenic
976695767 4:87918482-87918504 CTGCAGGCAGGCTTGGAGAGGGG - Intergenic
977279891 4:95026734-95026756 AGGGAGGCAGGGAGGGAGAAGGG - Intronic
977870321 4:102082883-102082905 AGGGAGGGAGGGTGGGAGAGAGG - Intergenic
977928980 4:102731324-102731346 CTGGAGGCTGGCTGGGATAGTGG - Intronic
977978703 4:103297389-103297411 CTGGATGGAGGGTGGGAGGAGGG - Intergenic
978561941 4:110042703-110042725 TGGGTGGGAGGGTGGGAGATGGG + Intergenic
978897609 4:113907937-113907959 CAGGATGGAGGGTGGGAGAAGGG + Intronic
980126226 4:128776870-128776892 CTGGAGCCAGGGTTGGGCATGGG + Intergenic
981610648 4:146590376-146590398 CTGGAGCCTGGGTGAGAGACAGG + Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
982045748 4:151443932-151443954 CTAGAGGCAGAGGGAGAGATGGG + Intronic
982080674 4:151786711-151786733 AAGAAAGCAGGGTGGGAGATAGG - Intergenic
982108079 4:152028731-152028753 CTGATGGCGGGGTTGGAGATTGG + Intergenic
982759718 4:159266857-159266879 CTGAAGACAGGGTGGGAAAACGG - Intronic
982963611 4:161873512-161873534 ATGGAGGGAGGGTGGGAGGAAGG - Intronic
983045829 4:162985215-162985237 CTGGAGGCTGCTGGGGAGATCGG + Intergenic
983077784 4:163345930-163345952 CTGGAGGCAGGGAGGGGGGGTGG - Intronic
983565570 4:169147471-169147493 ATGGGGGCAGGGTGGGGGAATGG + Intronic
983890582 4:173025584-173025606 CTGGCTTCAGGGTGGAAGATGGG - Intronic
984350792 4:178589828-178589850 CCGGGGGCAGGGTGGGGGGTGGG + Intergenic
984610944 4:181836340-181836362 CTGGAGGTAGGGGTGGAGAGTGG - Intergenic
984959474 4:185081592-185081614 TGGGAGGCAGGGTGGAGGATGGG - Intergenic
985324916 4:188756001-188756023 CTGGTGGCAGGGTGGGGGGAGGG + Intergenic
985450142 4:190057271-190057293 GTGGGGGCAGGGTGGGTGAAGGG - Intergenic
985643649 5:1074990-1075012 GTGGAGGGAGGGTGGGTGCTGGG + Intronic
985783983 5:1884833-1884855 GAGGAGGGAGGGTGGGAGAGGGG - Intronic
985796659 5:1967095-1967117 CTGGAGTTATGCTGGGAGATGGG + Intergenic
985956247 5:3268268-3268290 CAGGAGGCAGGGCTGGAGAGAGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
987024243 5:13908056-13908078 CTATTGGCAGGGTGGGGGATGGG + Intronic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987258119 5:16178933-16178955 CTGGAGGCAAACTGGGAGGTAGG + Intronic
987681502 5:21142899-21142921 CTGGAGGGTGGGTGGGATGTTGG + Intergenic
987826658 5:23038651-23038673 CTGGTCGCAGTGTGGGAGAGGGG + Intergenic
987984520 5:25128772-25128794 TTGGGGGCAGGTTGGGAGACTGG - Intergenic
988039321 5:25868943-25868965 CTGGAAGCAGGGAGAGACATAGG + Intergenic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
991429581 5:66530388-66530410 AAGGAGGCAGGGAGGGAGAAAGG - Intergenic
991715111 5:69444499-69444521 CTGGAAGCAGGGTGTCAGCTGGG + Intergenic
992170291 5:74094885-74094907 CAGGAGCCATGGTGGGGGATGGG - Intergenic
994114680 5:96048967-96048989 CTGGAGCCAGGGTGAGTGAGAGG + Intergenic
994370645 5:98963601-98963623 CTGGGGGGAGGGTTGGGGATGGG + Intergenic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
995773429 5:115698213-115698235 AAGCAGGCAGAGTGGGAGATTGG + Intergenic
996009508 5:118465937-118465959 AGGGAGGCAGGGAGGGAGAGAGG + Intergenic
996477456 5:123937487-123937509 CAGGCGGCAGGGTGGGGGTTGGG + Intergenic
996758810 5:126966171-126966193 CTGGAGGCAAAGTGGGTGTTGGG + Intronic
996865643 5:128118564-128118586 CGGGTGGAAGGGTGGGAGGTGGG + Intronic
996946698 5:129078980-129079002 CTGGAGCCAGGGTGGAAGAAGGG + Intergenic
997355359 5:133259321-133259343 CTTGAGGCAGGGTGGGGGCTTGG + Intronic
997384913 5:133464978-133465000 CTGAAGGCAGGTTGGAAAATAGG - Intronic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
997695477 5:135857726-135857748 TTGGGAGCAGGGTGGGAGAAGGG + Intronic
997725068 5:136113581-136113603 ATGGAGGCATGGAGGGAGAGAGG + Intergenic
998396429 5:141821544-141821566 CAGGAGGCAGGGATGCAGATGGG - Intergenic
998399085 5:141838635-141838657 CCAGAAGCAGGGTGGGAGAGAGG + Intergenic
998550670 5:143074964-143074986 CTGGTGCCAAGGTGTGAGATAGG + Intronic
998770025 5:145532611-145532633 CTGGGGGCAGGATGGGGAATGGG - Intronic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1000233423 5:159336088-159336110 GTGGGGGCAGGGTGGGCCATGGG - Intergenic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1000967018 5:167669714-167669736 CAGACGGCAGGGTGGCAGATGGG + Intronic
1001340296 5:170837321-170837343 CTGGAGGCAGGGTTGTGGACTGG - Intergenic
1001423114 5:171601756-171601778 CTCCAGGGTGGGTGGGAGATGGG + Intergenic
1001557334 5:172645670-172645692 CTGGTGGAAGGGAGGAAGATGGG - Intronic
1001756236 5:174172486-174172508 CTGGAGGCAGAGGAGGTGATAGG + Intronic
1002078415 5:176723457-176723479 CTGGAGGCTGGGGGGGAGAGTGG - Intergenic
1002099357 5:176849755-176849777 GTGGAGGCAGAGTGGGGGCTGGG + Intronic
1002189971 5:177473107-177473129 CGGGGGGTAGGGTGGGGGATGGG + Exonic
1002279626 5:178122794-178122816 ATGGAGGGAGGGAGGGAGACAGG - Exonic
1002519052 5:179780512-179780534 CTGGAGGCAGGGCTGCAGAACGG + Intronic
1002663177 5:180804420-180804442 CTGGAGGTGGAGTGGGAGAAGGG + Intronic
1003624579 6:7729322-7729344 CTGGAGGCGGGGTGGGGGCGGGG - Intronic
1003879305 6:10465748-10465770 CTGGAGGTGGGGTGGGGGAGGGG + Intergenic
1004495174 6:16156178-16156200 CTGGAGGCAGGGTGGGCCATGGG + Intergenic
1005244098 6:23861991-23862013 CTGCAGGCTGGGTGGGAGTGGGG + Intergenic
1005603865 6:27455637-27455659 TTGGAGGCAGGGCGGGGGTTGGG + Intronic
1005681866 6:28216439-28216461 AGGGAGGTAGGGTGGGATATTGG - Intergenic
1006148236 6:31971846-31971868 CTGGAGGGAGGGTGGGTGAAGGG - Intronic
1006190043 6:32202037-32202059 CTGGAGCCAGGGAAGGAGAGGGG - Intronic
1006729873 6:36228879-36228901 CTGGAGGCAGAATAGAAGATGGG - Intronic
1006781797 6:36637255-36637277 CTGGAGGGAGGGGGCGTGATGGG - Intergenic
1006782821 6:36643639-36643661 CTGGAGGCAGGTTCAGAGCTGGG - Intergenic
1006804428 6:36778958-36778980 CTGGTGGGAGGGAGGGAGAACGG + Intronic
1006924482 6:37647076-37647098 CCAGAGGAAGGGTCGGAGATGGG - Intronic
1007164131 6:39816534-39816556 CTGGGGGCAGGGGGTGTGATGGG + Intronic
1007228528 6:40331620-40331642 CAGGAGGCAGCCTGGGAGAGAGG - Intergenic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007400517 6:41600010-41600032 CTGGGGCCGGGGTGGGAGACTGG - Exonic
1007445491 6:41902331-41902353 CAGGAGGCAGTGTGGGAGCAGGG + Intergenic
1007690626 6:43699007-43699029 ATGAAGGCAGGGAGGGGGATGGG + Intergenic
1007883293 6:45191609-45191631 CTGTAGGGAGGGTGGCAGGTAGG + Intronic
1007916905 6:45569531-45569553 CTGGATGGAGGGAGGGAGACTGG + Intronic
1008001163 6:46361209-46361231 CTGGGGGAAGGGTGAGAGAAAGG + Intronic
1009984008 6:70760603-70760625 CTGGAGGGAGGGAGAGAGAAAGG - Intronic
1011817143 6:91205684-91205706 CAGGAGAAAGGGTGGGAGGTGGG - Intergenic
1013256805 6:108395759-108395781 CTTGAGGGAGGGAGGGAGATAGG + Intronic
1013370523 6:109466778-109466800 CCTGAGGAAGGGTGGCAGATGGG + Intronic
1013800768 6:113939293-113939315 CGGGAGGCATGGTGGGAGGGGGG + Exonic
1013933742 6:115568536-115568558 CCGGGGGGAGGGTGGGAGAGGGG + Intergenic
1014248363 6:119091722-119091744 CTGGAGGGAGGATGAGGGATCGG + Intronic
1015863354 6:137703178-137703200 CTGGAGGCAAGGAGGTAGGTGGG - Intergenic
1016842039 6:148534304-148534326 CTGGAGTGATGGTGGGAGAGAGG - Intronic
1016937102 6:149455590-149455612 CTGGAGGCAGAGAGGGACACAGG - Intronic
1017022657 6:150152729-150152751 CTGCAGTGAGGGTGGGAGACAGG - Intronic
1017744586 6:157435342-157435364 ATGGAGGGAGGGTAGGAGAAGGG + Intronic
1017879143 6:158547745-158547767 CCGGGGGCAGGGTGGGAGACGGG - Intronic
1018576009 6:165260962-165260984 CAGAGGACAGGGTGGGAGATGGG - Intergenic
1019414154 7:919801-919823 ATGGGGGGAGGGAGGGAGATGGG + Intronic
1019451441 7:1100723-1100745 CGGGAGGCAGGGAGGCAGAGGGG - Intronic
1019464780 7:1181620-1181642 CTGGAGGCAGGCAGGCAGGTAGG + Intergenic
1019479543 7:1260199-1260221 CTGGGGGCAGGGGGAGAGAGAGG - Intergenic
1019521639 7:1463384-1463406 CTGGAGGGAGGGGAGGAGACAGG + Intergenic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1019542609 7:1558352-1558374 CTGCAGGCCGGGTGGGAGGCCGG - Intronic
1019630227 7:2045145-2045167 GTGGAGGCCGGGTGGGAGGCCGG - Intronic
1019704137 7:2489453-2489475 CTGGAGGAGGGGTGGGAGAAAGG + Intergenic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1019740453 7:2670409-2670431 GTGGAGGCAGAGTGGGAGGCGGG + Intergenic
1019779248 7:2929888-2929910 CTGGAGGGAGAGTGGGTGGTGGG + Intronic
1020024342 7:4888381-4888403 CTGGAGGGAGGGGGTGAGAGTGG - Intergenic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1021806678 7:24364140-24364162 CTGGAGGCTGGGTGGAAGGATGG - Intergenic
1022186405 7:27973864-27973886 ATGGAGGCAGGCAGGGAGATCGG + Intronic
1022580497 7:31548603-31548625 CTCCAGGAAGGGTGGAAGATTGG + Intronic
1022814401 7:33900733-33900755 CTTGAGGCAGGGATTGAGATGGG + Intergenic
1022855583 7:34310435-34310457 CTGGAGGAAGAGTCTGAGATGGG - Intergenic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023262450 7:38371710-38371732 CTGGAGTTAGGGGGAGAGATAGG - Intergenic
1023868722 7:44251558-44251580 TTGGAGGCTGAGTGGGAGAGGGG - Intronic
1023912432 7:44565549-44565571 CTGGGATCAGGCTGGGAGATGGG - Exonic
1024608987 7:51046743-51046765 CTGGACAGAGGGTGGGAAATGGG - Intronic
1024713955 7:52053290-52053312 CTGGAGGGAGGGAGGGAGGGAGG - Intergenic
1026365404 7:69643633-69643655 CTGGGGGCGGGGTGGGGGGTTGG - Intronic
1026833095 7:73622012-73622034 AGGGAGGGAGGGAGGGAGATGGG - Intronic
1028165886 7:87538199-87538221 CTGGAGGCTGGTTGGGTAATGGG + Intronic
1028284439 7:88978787-88978809 AGGGAGGCAGGGAGGGAGAGAGG - Intronic
1028540727 7:91940311-91940333 TTGGAGGCAGCGTGTGCGATGGG + Intergenic
1029544948 7:101205785-101205807 CTGGAGACAGTGTGTGAGAGGGG - Intergenic
1029544986 7:101205932-101205954 CTGCTGGCAGGAGGGGAGATGGG + Intergenic
1029633286 7:101766965-101766987 CTGGGAGCAGGGTGGGTGAGTGG - Intergenic
1029702406 7:102256068-102256090 CAAGAGGCAGGCTGGGAGACTGG - Exonic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030629312 7:111878590-111878612 ATGGGGGAGGGGTGGGAGATGGG - Intronic
1031147564 7:118013917-118013939 CTGGTGGCAGGGTGGGGTGTGGG - Intergenic
1031981603 7:128130526-128130548 CTGGAGTCAGGGTGGAGGTTAGG + Intergenic
1032094347 7:128930080-128930102 CTGGAGGGAGGGAGGGAGAGTGG + Intergenic
1032754074 7:134871645-134871667 CTGCAGACAGTGTGGGGGATGGG + Intronic
1032845181 7:135745868-135745890 CTGGAGGTAGGGTGGGGGTAAGG + Intronic
1033898039 7:146099355-146099377 TTGGAGGCAGGGTGGGAGTGGGG + Intergenic
1033966891 7:146986148-146986170 ATGGAGAAAGGGTGGGAGAGGGG - Intronic
1034073865 7:148213575-148213597 TTGGAGGGAGGGTGGGAGGCAGG - Intronic
1034271874 7:149807004-149807026 GTGGGGGCAGTGTGGGAGAGGGG + Intergenic
1034843058 7:154417553-154417575 CTGGGAGCGGGGTGGGAGGTGGG - Intronic
1034915325 7:155034098-155034120 TGGGTGGCAGGGTGGGAGTTGGG - Intergenic
1035275432 7:157745421-157745443 CGGGAGGCAGGTTGGGGGAGAGG + Intronic
1035325035 7:158060347-158060369 CTGGGGGCTGCATGGGAGATGGG - Intronic
1035413485 7:158665287-158665309 CTGGAGGCTGCATGTGAGATGGG - Intronic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1035713491 8:1736719-1736741 CGGGAGAAAGGGAGGGAGATGGG + Intergenic
1035992374 8:4506509-4506531 CAGGAGGCGGGGTTGGGGATGGG + Intronic
1036109139 8:5878557-5878579 CTGGAGGAAGGGTGAGGGAGTGG - Intergenic
1036114285 8:5941622-5941644 CTCGGGGAAGGGTGGGAGGTGGG + Intergenic
1036442041 8:8789937-8789959 CTGGGGGCAGGAGGGGAGAGGGG - Intronic
1036457205 8:8920225-8920247 ATGGAGGGAGGGAGGGAGAGAGG + Intergenic
1036457214 8:8920249-8920271 ATGGAGGGAGGGAGGGAGAGAGG + Intergenic
1036701844 8:11018213-11018235 CTGATGGCAGGGAGGGAGTTGGG - Intronic
1037542408 8:19885327-19885349 CTGGGGGCAGGGTGGGGACTTGG - Intergenic
1039322672 8:36449900-36449922 CTGGAGCCAGGCTGGGAAAGGGG - Intergenic
1039352980 8:36782385-36782407 AGGGAGGCAGGGAGGGAGGTAGG - Intergenic
1039518950 8:38154564-38154586 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1039811137 8:41049277-41049299 CTGCAGTCACTGTGGGAGATGGG - Intergenic
1039847805 8:41338183-41338205 CTGGAGGGGGGCTGGGGGATGGG - Intergenic
1039941916 8:42098508-42098530 CTGGGTGCAGGGAGGGGGATAGG - Intergenic
1041176999 8:55207236-55207258 CTGGGGGCAGGGTGGGGCAGTGG + Intronic
1041183424 8:55272570-55272592 CTGGGGGCAGGCTGGCAGACAGG - Intronic
1042148782 8:65759411-65759433 CTGAAGCCAGGGTGGGAAGTGGG - Intronic
1042814291 8:72861624-72861646 CTGCAGGCAGGCTGGGTGAGCGG - Intronic
1043868082 8:85398555-85398577 CTTGAGGCAGGGAGGAAGAGAGG + Intronic
1043941368 8:86199137-86199159 CTTGAGACAGGGTGGGACAGGGG - Intergenic
1044890330 8:96828413-96828435 CTGGAGGGTGGGTAGGAGAGAGG - Intronic
1045147815 8:99367588-99367610 GTGGAGGCAGGGAGAGATATAGG - Intronic
1045352457 8:101354565-101354587 CTGGAGGAAGTATGAGAGATAGG + Intergenic
1045421718 8:102022974-102022996 CTGAAGGGAGGGTGTGAGATGGG - Intronic
1045482574 8:102603914-102603936 CTGGAGGATGGGTTGGAGGTTGG - Intergenic
1046709882 8:117499116-117499138 GTGGGGGCAGGGTGGGCCATAGG - Intergenic
1046743452 8:117852416-117852438 CTGGAAGTAGTGTGTGAGATGGG - Intronic
1047008235 8:120643417-120643439 CAGGAGGAAGGGTGGGAGGGTGG - Intronic
1048363203 8:133715504-133715526 ATGGAGGGAGGGAGGGAGAGGGG - Intergenic
1048522155 8:135166423-135166445 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1048644639 8:136406314-136406336 CTGGAAGCAGGGAGGCAGAAAGG + Intergenic
1049146068 8:141001639-141001661 TTGGGGGCAGGGAAGGAGATGGG - Intronic
1049264574 8:141660552-141660574 CTCGAGGGAGGGTGGGAGCTTGG + Intergenic
1049305183 8:141899100-141899122 CTGGAGTCAGGGTGGCCCATGGG + Intergenic
1049418745 8:142507509-142507531 CTGGGGGCAGGGAGAGAGACGGG - Intronic
1049426386 8:142539778-142539800 CAGGAGGCAGGGGGGGGGAGCGG - Intronic
1049759069 8:144323756-144323778 CTGGAGACAGGGTGGCGGGTGGG - Intronic
1049803710 8:144529774-144529796 CTGGGGGCAGGGTGGGGGAGGGG - Exonic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050268791 9:3919477-3919499 CTGTTGGGAGGGTGGAAGATGGG + Intronic
1050593152 9:7180581-7180603 CAGGAGGCACGGTGTGAGGTAGG + Intergenic
1050715747 9:8523205-8523227 TTAAAGGCAGGGTGGGAGATGGG + Intronic
1051960240 9:22751648-22751670 CAGAATGCAGGGTGGGAGAGAGG + Intergenic
1052993095 9:34533572-34533594 CATGGGGCAGGGTGGGAGGTGGG + Intergenic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053358298 9:37465351-37465373 CTAGAGGCGGGGTGGGAGGGGGG - Exonic
1053425503 9:38007472-38007494 TTGGCGTCAGGGTGGGAGTTGGG - Intronic
1053788498 9:41669483-41669505 CTGGGGGCAGGGGTAGAGATGGG - Intergenic
1054156641 9:61645285-61645307 CTGGGGGCAGGGGTAGAGATGGG + Intergenic
1054476411 9:65576294-65576316 CTGGGGGCAGGGGTAGAGATGGG + Intergenic
1054660752 9:67699984-67700006 CTGGGGGCAGGGGTAGAGATGGG + Intergenic
1055550947 9:77431792-77431814 CTGGAGGGAGGATGACAGATGGG - Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1055889236 9:81105256-81105278 GTGGAGGCAGGTTGGGAGTGAGG - Intergenic
1056292734 9:85160339-85160361 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1056292874 9:85161310-85161332 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1056546072 9:87614946-87614968 CTGGAGTGAGGGTTGGAGACAGG + Intronic
1056704394 9:88939754-88939776 CTGGAGGGAAGGTGGGAGAGGGG - Intergenic
1056754404 9:89373013-89373035 CAGGAGCTGGGGTGGGAGATTGG - Intronic
1056769408 9:89465990-89466012 TTGGAGGCAGGGGGGAAGGTGGG + Intronic
1057177475 9:93010551-93010573 ATGGAGACAGGGAGAGAGATAGG + Intronic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1057795824 9:98157407-98157429 CTGGAGGCAGGGCAGGACAGAGG - Intronic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1058590227 9:106557721-106557743 ATGGAGGCAGGGAGGGAGTGGGG - Intergenic
1058852585 9:109027186-109027208 CCGGAAGTAGGGTGGGAGATGGG + Intronic
1059176609 9:112174829-112174851 CAGGAGGCGGGGTGGGGGCTGGG - Intronic
1059506442 9:114803670-114803692 TTGGAGGCAGGGTGGGGGATGGG + Intronic
1059638205 9:116191043-116191065 AAGGAGGGAGGGAGGGAGATAGG + Intronic
1059776700 9:117483339-117483361 CTAAGGGCAGGGTGGGAGCTTGG - Intergenic
1060377576 9:123130895-123130917 CTGGAGGCAGGGAAGAAGAAAGG - Intronic
1060491491 9:124088461-124088483 ATGGAGGGAGGGTGGTAGAAAGG - Intergenic
1060775000 9:126366736-126366758 CAGGAGGCTGGGTGGGAACTGGG - Intronic
1060799879 9:126537163-126537185 CTGGAGGGGGGGAGTGAGATGGG - Intergenic
1060859373 9:126941494-126941516 AAGTAGGCAGGGTGGGAGACAGG - Intronic
1060930625 9:127487422-127487444 CTGGTGGCAGGTTGGGTGAGAGG + Intronic
1061056238 9:128224459-128224481 GAGGAGGCAGGGGGGGACATGGG - Intronic
1061058936 9:128240812-128240834 CTCCATGCAGGGTGGGAGTTGGG + Intronic
1061176567 9:129001255-129001277 GTGGTGGCAGTGTGGGAGGTGGG + Intronic
1061216537 9:129224929-129224951 CAGGAGGCAGCGTAGGAGAGAGG + Intergenic
1061235021 9:129337137-129337159 CTGGAGGCAGGAGGGGAGCCGGG + Intergenic
1061843680 9:133375490-133375512 CCGGAGGCGGGCTGGGAGCTCGG - Intronic
1061911116 9:133725200-133725222 CTGGGGACAGGGTGGGAAATGGG + Intronic
1061923026 9:133792687-133792709 CTGGATGCTGGGTGGGGGGTGGG - Intronic
1062011736 9:134270833-134270855 CTGGGGGCAGGGGAGGGGATGGG + Intergenic
1062046169 9:134425534-134425556 GTGGCGGCAGGGTGGGGGGTGGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062218573 9:135402399-135402421 CTGCAGGCAGGGTGGGCAAAGGG - Intergenic
1062491293 9:136806296-136806318 CTGCAGCCAGGCTGGGAGCTGGG + Intronic
1062715898 9:138009914-138009936 CTGGAGGCTGGTTGGGATCTGGG + Intronic
1185566257 X:1097632-1097654 CTGGAGGAAAGGTGGGTGAGAGG + Intergenic
1185923196 X:4116730-4116752 CTGGAGGGAAGGTGGGGGAGGGG + Intergenic
1186704375 X:12126505-12126527 CTGCAGGAAGGGTGAGAGAGAGG + Intergenic
1186704888 X:12130393-12130415 CTGGATGCTGGATGGGAGGTGGG + Intergenic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187720764 X:22148633-22148655 CTGGAGGGAGGGGGAGAGATAGG - Intronic
1187984660 X:24797209-24797231 ATGGAGAGAGGGTGGGAGAGAGG - Intronic
1188005842 X:25015346-25015368 CTGGAAGCAGGGAGGGAGGGAGG + Intronic
1188058972 X:25577057-25577079 CTGGAGCCAGGGTGGGGGTTAGG - Intergenic
1188378450 X:29462555-29462577 CTGGAGGCAGCAGGGGAGAGAGG - Intronic
1188423728 X:30022414-30022436 TTGGAGGCAAGGAGGGAGGTTGG - Intergenic
1188680930 X:33003137-33003159 CAGGGGGAAGGGTAGGAGATGGG - Intronic
1188708894 X:33369962-33369984 TTGGCGGAAGGGTGGGAGAAGGG - Intergenic
1188745190 X:33832739-33832761 GTGGAGGCTGGGTGGGAGATGGG - Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190107037 X:47568435-47568457 CTGTAGGCAGGGAGGGGGAGGGG + Intronic
1190118221 X:47639386-47639408 CTGGAGGCAGGGTGTCAGGGGGG + Intronic
1190325515 X:49204844-49204866 CTGGAGGCAGAGTGGAGGAGGGG - Intergenic
1190358579 X:49627987-49628009 CTGGAGGCAGGGTGCCTGCTGGG - Intergenic
1191714131 X:64182533-64182555 CTGGGGGTTGGGTGGGGGATGGG + Intergenic
1192233945 X:69284536-69284558 CTGGGGGCAGGATGGGAGGTGGG - Intergenic
1192435489 X:71141126-71141148 GAGGAAGCAGGGTGGGAGCTCGG - Intronic
1192547182 X:72023802-72023824 CTGGAGGCAGGGAGGCTGGTGGG + Intergenic
1192583708 X:72304833-72304855 CTGGGGTCAGGGTGGGTGGTGGG - Intronic
1192639456 X:72848107-72848129 GGGGAGGCAAGATGGGAGATGGG + Intronic
1192642255 X:72872698-72872720 GGGGAGGCAAGATGGGAGATGGG - Intronic
1192946377 X:75968471-75968493 CTGGAGTAAGGGTGGGGCATGGG + Intergenic
1192991845 X:76467696-76467718 GGGGAGGCATGGTGTGAGATTGG - Intergenic
1193037418 X:76967126-76967148 TTGAAGGCAGGGTGGGAGCTAGG + Intergenic
1194350765 X:92823152-92823174 CTTGAGGCAGGTTGGGGGATTGG + Intergenic
1195129752 X:101840586-101840608 CTGGAGTCGGCGTGGGAGTTGGG - Exonic
1195176048 X:102316458-102316480 CTGGAGGCAGGAGGGCAGCTTGG + Intronic
1195176484 X:102319237-102319259 CTGGAGTCGGCGTGGGAGTTGGG + Exonic
1195182380 X:102367856-102367878 CTGGAGTCGGCGTGGGAGTTGGG - Exonic
1195182816 X:102370635-102370657 CTGGAGGCAGGAGGGCAGCTTGG - Intronic
1196362765 X:114885024-114885046 GAGGAGGGAGGGTGGGAGAAGGG + Intronic
1196767609 X:119262393-119262415 TTGGAGGTAGGGAGGGAGGTAGG + Intergenic
1196934983 X:120720754-120720776 TGGGAGGAAGGGTGGGAGGTGGG - Intergenic
1197145898 X:123171957-123171979 GTGGAGGCAGGGTGACAGAGAGG + Intergenic
1197530370 X:127616707-127616729 CTGGAGGTAGTGTGCCAGATTGG - Intergenic
1198178068 X:134174571-134174593 TGGGAGGAGGGGTGGGAGATGGG - Intergenic
1199766509 X:150945490-150945512 ATGAAGGCAGGGTGGGAAGTAGG - Intergenic
1200072360 X:153535524-153535546 CCGGAGGAAGGGTGGGAAACAGG - Intronic
1200225256 X:154413419-154413441 CTGGGGGCAGGGTGGTGGAGCGG + Intronic
1200659092 Y:5939832-5939854 CTTGAGGCAGGTTGGGGGAATGG + Intergenic