ID: 1064064081 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:12165817-12165839 |
| Sequence | GGCAGGCAGGATAGTGACAG TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 357 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 33, 4: 322} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064064077_1064064081 | 6 | Left | 1064064077 | 10:12165788-12165810 | CCAAATAATCGCAGGGCAAGGCA | 0: 1 1: 0 2: 0 3: 2 4: 81 |
||
| Right | 1064064081 | 10:12165817-12165839 | GGCAGGCAGGATAGTGACAGTGG | 0: 1 1: 0 2: 1 3: 33 4: 322 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064064081 | Original CRISPR | GGCAGGCAGGATAGTGACAG TGG | Exonic | ||