ID: 1064064081

View in Genome Browser
Species Human (GRCh38)
Location 10:12165817-12165839
Sequence GGCAGGCAGGATAGTGACAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064064077_1064064081 6 Left 1064064077 10:12165788-12165810 CCAAATAATCGCAGGGCAAGGCA 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1064064081 10:12165817-12165839 GGCAGGCAGGATAGTGACAGTGG 0: 1
1: 0
2: 1
3: 33
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064064081 Original CRISPR GGCAGGCAGGATAGTGACAG TGG Exonic