ID: 1064066039

View in Genome Browser
Species Human (GRCh38)
Location 10:12182266-12182288
Sequence CTCCAGCTGGGGCATCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064066032_1064066039 23 Left 1064066032 10:12182220-12182242 CCTGTGTTCTGACTGCAGCCTGT 0: 1
1: 0
2: 5
3: 35
4: 282
Right 1064066039 10:12182266-12182288 CTCCAGCTGGGGCATCATGTTGG No data
1064066034_1064066039 5 Left 1064066034 10:12182238-12182260 CCTGTCACACAGAGTCAGGTGTG 0: 1
1: 0
2: 4
3: 34
4: 490
Right 1064066039 10:12182266-12182288 CTCCAGCTGGGGCATCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064066039 Original CRISPR CTCCAGCTGGGGCATCATGT TGG Intronic
No off target data available for this crispr