ID: 1064079219

View in Genome Browser
Species Human (GRCh38)
Location 10:12294778-12294800
Sequence GAAACCCCGGATTTCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064079219_1064079222 13 Left 1064079219 10:12294778-12294800 CCTGGATGGAAATCCGGGGTTTC No data
Right 1064079222 10:12294814-12294836 GCTGGTCAACCAGTTCTCTATGG No data
1064079219_1064079221 -5 Left 1064079219 10:12294778-12294800 CCTGGATGGAAATCCGGGGTTTC No data
Right 1064079221 10:12294796-12294818 GTTTCTCAGTAACAGCATGCTGG No data
1064079219_1064079223 14 Left 1064079219 10:12294778-12294800 CCTGGATGGAAATCCGGGGTTTC No data
Right 1064079223 10:12294815-12294837 CTGGTCAACCAGTTCTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064079219 Original CRISPR GAAACCCCGGATTTCCATCC AGG (reversed) Intergenic
No off target data available for this crispr