ID: 1064079223

View in Genome Browser
Species Human (GRCh38)
Location 10:12294815-12294837
Sequence CTGGTCAACCAGTTCTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064079219_1064079223 14 Left 1064079219 10:12294778-12294800 CCTGGATGGAAATCCGGGGTTTC No data
Right 1064079223 10:12294815-12294837 CTGGTCAACCAGTTCTCTATGGG No data
1064079220_1064079223 1 Left 1064079220 10:12294791-12294813 CCGGGGTTTCTCAGTAACAGCAT No data
Right 1064079223 10:12294815-12294837 CTGGTCAACCAGTTCTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064079223 Original CRISPR CTGGTCAACCAGTTCTCTAT GGG Intergenic
No off target data available for this crispr