ID: 1064084912

View in Genome Browser
Species Human (GRCh38)
Location 10:12338209-12338231
Sequence GTGAGCAGGGGAAAAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064084905_1064084912 13 Left 1064084905 10:12338173-12338195 CCATCTGCGGCATAAATTCCACA No data
Right 1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG No data
1064084907_1064084912 -5 Left 1064084907 10:12338191-12338213 CCACAGAAACCTCAATTGGTGAG No data
Right 1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064084912 Original CRISPR GTGAGCAGGGGAAAAGCAGC TGG Intergenic
No off target data available for this crispr