ID: 1064084924

View in Genome Browser
Species Human (GRCh38)
Location 10:12338298-12338320
Sequence GTGTTTCTGAAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064084924_1064084928 3 Left 1064084924 10:12338298-12338320 CCTTCCTCCTTTTTCAGAAACAC No data
Right 1064084928 10:12338324-12338346 GAGAAGTAAAAGACCCACAGTGG No data
1064084924_1064084929 14 Left 1064084924 10:12338298-12338320 CCTTCCTCCTTTTTCAGAAACAC No data
Right 1064084929 10:12338335-12338357 GACCCACAGTGGCCCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064084924 Original CRISPR GTGTTTCTGAAAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr