ID: 1064086241

View in Genome Browser
Species Human (GRCh38)
Location 10:12348830-12348852
Sequence CCGCGCGGGCGCCCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064086241_1064086255 22 Left 1064086241 10:12348830-12348852 CCAGCACCAGGGCGCCCGCGCGG No data
Right 1064086255 10:12348875-12348897 TTGCTCGCAAAGGGACCACGAGG No data
1064086241_1064086246 -6 Left 1064086241 10:12348830-12348852 CCAGCACCAGGGCGCCCGCGCGG No data
Right 1064086246 10:12348847-12348869 GCGCGGCTGCCAAACACCCCCGG No data
1064086241_1064086247 -5 Left 1064086241 10:12348830-12348852 CCAGCACCAGGGCGCCCGCGCGG No data
Right 1064086247 10:12348848-12348870 CGCGGCTGCCAAACACCCCCGGG No data
1064086241_1064086254 13 Left 1064086241 10:12348830-12348852 CCAGCACCAGGGCGCCCGCGCGG No data
Right 1064086254 10:12348866-12348888 CCGGGAGTTTTGCTCGCAAAGGG No data
1064086241_1064086252 12 Left 1064086241 10:12348830-12348852 CCAGCACCAGGGCGCCCGCGCGG No data
Right 1064086252 10:12348865-12348887 CCCGGGAGTTTTGCTCGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064086241 Original CRISPR CCGCGCGGGCGCCCTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr