ID: 1064086317

View in Genome Browser
Species Human (GRCh38)
Location 10:12349102-12349124
Sequence CGCTGTGGCCTGTGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064086317_1064086326 -1 Left 1064086317 10:12349102-12349124 CCCCCGGGCCACAGGCCACAGCG No data
Right 1064086326 10:12349124-12349146 GCGGGAAGGCGCCCCGCCCTCGG No data
1064086317_1064086330 13 Left 1064086317 10:12349102-12349124 CCCCCGGGCCACAGGCCACAGCG No data
Right 1064086330 10:12349138-12349160 CGCCCTCGGCGCCCCGCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064086317 Original CRISPR CGCTGTGGCCTGTGGCCCGG GGG (reversed) Intergenic
No off target data available for this crispr