ID: 1064086428

View in Genome Browser
Species Human (GRCh38)
Location 10:12349396-12349418
Sequence CGAAGGCGGCGCGCTGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064086418_1064086428 9 Left 1064086418 10:12349364-12349386 CCGGCGCTCTTGGGAGGGGAGCG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG 0: 1
1: 0
2: 1
3: 12
4: 152
1064086413_1064086428 16 Left 1064086413 10:12349357-12349379 CCGTGGCCCGGCGCTCTTGGGAG 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG 0: 1
1: 0
2: 1
3: 12
4: 152
1064086417_1064086428 10 Left 1064086417 10:12349363-12349385 CCCGGCGCTCTTGGGAGGGGAGC 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG 0: 1
1: 0
2: 1
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064086428 Original CRISPR CGAAGGCGGCGCGCTGGAGG CGG Intergenic
901577051 1:10210060-10210082 CGAACGCGGCGCGGTGGGAGCGG - Intergenic
905847146 1:41242312-41242334 GCGGGGCGGCGCGCTGGAGGAGG + Intergenic
908355685 1:63323340-63323362 CGACGTGGGCGCGCCGGAGGCGG + Exonic
908813854 1:68011610-68011632 CGGAGTCGGGGCGATGGAGGGGG + Intergenic
914822887 1:151118887-151118909 AGGAGGCTGCGCCCTGGAGGCGG - Exonic
915522801 1:156457611-156457633 CAAAGGTGGCGGGGTGGAGGGGG + Intergenic
920021182 1:202957968-202957990 CGGAGGCGGCGCGCAGTGGGAGG + Intronic
923631374 1:235650669-235650691 CGGAGGGCGCGTGCTGGAGGCGG + Intronic
924436843 1:244049348-244049370 GGAGGGCGGCGGGCTGGGGGAGG + Intronic
924957687 1:248945017-248945039 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG + Intergenic
1067362480 10:45594969-45594991 CGACTGCAGCGCGCTGGGGGCGG + Intergenic
1071598209 10:86943043-86943065 CGAGGTGGGCGCGCTGAAGGCGG - Exonic
1073403440 10:103277077-103277099 CTGGGGCGGCGCGCTGGGGGCGG - Intergenic
1073520220 10:104121686-104121708 TGGAGGCGGCGGGCTGGCGGGGG + Intergenic
1074182991 10:111079111-111079133 CCAAGGCGTCGCGCTGGCGCGGG + Exonic
1076163422 10:128263401-128263423 CCAAGGCTGGGAGCTGGAGGTGG - Intergenic
1076909531 10:133379994-133380016 CGCAGGTGGCGTGGTGGAGGTGG + Exonic
1076963535 10:133786531-133786553 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1083572510 11:63768225-63768247 CCAAGGCGGGGCGCTGCGGGCGG + Intronic
1083648531 11:64186616-64186638 CGCAGGGGGCGGGGTGGAGGTGG + Intronic
1085395789 11:76206528-76206550 TTAAGGCGGCGCGCGGGCGGGGG + Exonic
1086362072 11:86069397-86069419 CGAGGGCGGTGTGCTGGCGGGGG + Intronic
1089684331 11:120137407-120137429 GGAAGGCGGCGCCCTCCAGGTGG + Exonic
1090377794 11:126303810-126303832 CGAAAGCGGCGGGCTAGAGGTGG - Exonic
1091697651 12:2638792-2638814 GCAAGGAGGCGGGCTGGAGGCGG + Intronic
1092391275 12:8082224-8082246 CGGAGGCGGAGCACGGGAGGCGG - Exonic
1093925213 12:24902799-24902821 GGAAGACGCCTCGCTGGAGGCGG + Intronic
1094167893 12:27461398-27461420 TGAAGGTGGAGGGCTGGAGGAGG - Intergenic
1094844889 12:34357152-34357174 CCAAGGCGGCCAGCTGAAGGCGG - Intergenic
1095160090 12:38905650-38905672 CGGAGGCAGCGCGCGGGATGGGG + Intronic
1095957065 12:47813096-47813118 TGGAGGCGGGGAGCTGGAGGCGG - Intronic
1097107590 12:56634672-56634694 CGAAGAAGGCGCGGGGGAGGGGG + Intronic
1099989846 12:89709646-89709668 GGGAAGGGGCGCGCTGGAGGGGG - Intergenic
1102954740 12:117052224-117052246 GGAATGGGGCGCCCTGGAGGTGG + Intronic
1103852168 12:123940409-123940431 CCAAGGCTGCACCCTGGAGGAGG - Intronic
1103926915 12:124428253-124428275 CGAAGGCTGGGCGCCGGAGCTGG - Intronic
1104623932 12:130337913-130337935 CGAGGCCGGCGCCCGGGAGGCGG + Exonic
1105011933 12:132761888-132761910 TGACGGCGCCGCGCTCGAGGCGG + Exonic
1107467880 13:40666078-40666100 CGACGGCGCCGGGCTGGAGGTGG + Exonic
1113779757 13:112969278-112969300 CGGAGGGGGCGCGGCGGAGGCGG - Exonic
1113861528 13:113490581-113490603 CGCAGGCGGCGCGCTGGATGTGG - Intronic
1113989971 13:114353410-114353432 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1115028144 14:28766478-28766500 CGGAGCCGGCGGGGTGGAGGGGG + Intergenic
1115399417 14:32939806-32939828 GGAAGGCGGCGAGCAGGGGGAGG + Intronic
1117478397 14:56119060-56119082 CGGACGCGGCGCGCGGGAAGTGG - Intronic
1119873034 14:78032962-78032984 AGAAGGCGGTGCTCTGGTGGTGG - Intergenic
1121108879 14:91298647-91298669 CAAAGGCCGCCAGCTGGAGGCGG - Intronic
1122221000 14:100239122-100239144 GGAAGGCGGCGAGCGGGCGGGGG - Exonic
1127793307 15:62417253-62417275 CGAAGGAAGCACGCTGGAGAGGG - Intronic
1128067739 15:64775235-64775257 CTCCGGCGGCGCCCTGGAGGAGG - Exonic
1129116401 15:73367722-73367744 CGAGGGCTGCTCGCAGGAGGCGG + Exonic
1129348243 15:74938020-74938042 CGATGGCGGCGCGCGGGCTGAGG + Exonic
1132671108 16:1102676-1102698 GGAAGGCGGGGCGCTGGGGGCGG - Intergenic
1132807779 16:1783008-1783030 TGGAGGCGGCGGGATGGAGGCGG + Exonic
1139469423 16:67170401-67170423 CGGAGGCCGCGCGCTGGCTGGGG - Intronic
1140223332 16:73058987-73059009 CGGAGGGGACGCGCTGGAAGTGG + Intronic
1141683357 16:85556578-85556600 CGGCGGCGGCGCGATGGGGGCGG - Intergenic
1141694928 16:85614622-85614644 CGAGGGCAGCGTGCTGGCGGTGG + Intronic
1142665768 17:1462917-1462939 AGAGGGCGGCGCGCTGTGGGTGG - Intronic
1142876291 17:2853642-2853664 CGAGGCCGGGGCGCGGGAGGCGG + Intronic
1142957847 17:3533299-3533321 CCCAGGCGGCGTGTTGGAGGAGG - Intronic
1143516321 17:7420991-7421013 CGATGGCGGTGAGCTGGGGGCGG - Exonic
1146176415 17:30668529-30668551 CCAAGGGGCCCCGCTGGAGGGGG - Intergenic
1146219833 17:31008718-31008740 CGGAGGCGGCGGGCAGGACGGGG - Intergenic
1146349875 17:32084643-32084665 CCAAGGGGCCCCGCTGGAGGGGG - Intergenic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1147169890 17:38611835-38611857 GGAAGGCAGCTAGCTGGAGGTGG - Intergenic
1147307394 17:39573591-39573613 CGAAGGCCGCGCGCTAAAGCAGG - Intergenic
1147671857 17:42181002-42181024 CGGAGGGGGCGCGCTGTCGGAGG + Exonic
1148688307 17:49512943-49512965 CGAGGTCGGCTCGCTGGATGCGG - Exonic
1151802044 17:76384504-76384526 CGGAGGCGGCGCGCTGAGGCCGG + Intronic
1152355695 17:79806176-79806198 GGAAGGGGGCGCTCTGGGGGAGG + Intergenic
1152686362 17:81695618-81695640 GGAAGGCGAGGCCCTGGAGGCGG - Intronic
1152711225 17:81871256-81871278 CGGAGGCGGCGGGGCGGAGGCGG - Intronic
1153997448 18:10454570-10454592 CGGAGGAGGGGCCCTGGAGGGGG - Intergenic
1155507589 18:26548275-26548297 CGGAGGTGGGGGGCTGGAGGAGG - Intronic
1156149370 18:34224146-34224168 CGAAGGCAGGCCGCTGGCGGCGG + Intronic
1157863947 18:51165160-51165182 GGCAGGCGGAGCTCTGGAGGTGG - Intergenic
1159370021 18:67517067-67517089 CGGAGGAGTCGAGCTGGAGGAGG + Intergenic
1159798059 18:72867652-72867674 AGGACGCGGCGCGCGGGAGGCGG + Exonic
1160708828 19:541474-541496 CGAGGACGGCGAGGTGGAGGAGG + Exonic
1160719067 19:589753-589775 CGGAGGCGGCGCGCGGGGAGGGG + Intergenic
1160810570 19:1011284-1011306 AGAGGGAGGGGCGCTGGAGGCGG - Intronic
1161072362 19:2269294-2269316 AGAAGGACGCGCGCAGGAGGGGG + Intronic
1161438712 19:4279038-4279060 CGAGCGCGGAGCGCGGGAGGTGG - Exonic
1162550517 19:11355693-11355715 GGGAGGCGGCGAGCTGGGGGAGG + Intronic
1163252159 19:16132388-16132410 CGTGGGCGGGGCGTTGGAGGTGG - Exonic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1165854226 19:38870243-38870265 CGCAGGCCCCGCGCTGGAGACGG - Exonic
1166304257 19:41928598-41928620 CGGCGGCGGCGCGGGGGAGGGGG + Intronic
1166785184 19:45363292-45363314 CGCAGGCTGGGAGCTGGAGGAGG - Intronic
1167148968 19:47698248-47698270 CGAAGGCTGCACTTTGGAGGAGG + Intronic
1167501467 19:49851075-49851097 CCAAGGCGGCGCGGGGGAGCGGG - Intronic
1168728745 19:58607242-58607264 CAAAGGCGGCGCGCCGGCGGAGG - Intergenic
925344419 2:3160426-3160448 GGAAGGCGGCACCCTGAAGGCGG + Intergenic
934064933 2:88331673-88331695 TGGAGGCGGCACGTTGGAGGAGG + Intergenic
935591597 2:104850745-104850767 GGAAGGCGGAGAGCTGGAGGAGG - Intergenic
935696686 2:105776665-105776687 CGAGGGAGGCTGGCTGGAGGAGG - Intronic
936569833 2:113603713-113603735 CAAAGGCGGCGCGCCGGCGGAGG + Intergenic
938722281 2:134077319-134077341 CGAAGGGGGAGAGCTGGAAGGGG + Intergenic
941929924 2:170929274-170929296 AGCAGGCGGTGCGCTGGGGGCGG + Exonic
942276320 2:174326528-174326550 CGGGGGCGGGGCTCTGGAGGTGG - Intergenic
944547451 2:200812057-200812079 GGGAGGCGGCGGGCTGGATGCGG + Intronic
946386615 2:219387813-219387835 GGCAGGCGGCGCGGTGGGGGCGG - Exonic
948456509 2:238106968-238106990 CGAAGGCGACGGGCTGCTGGCGG + Intronic
1176306847 21:5128161-5128183 CGAAGGCTGATCTCTGGAGGCGG + Intronic
1179659615 21:42865912-42865934 CCCAGGCGGCTCTCTGGAGGGGG - Intronic
1179850210 21:44133869-44133891 CGAAGGCTGATCTCTGGAGGCGG - Intronic
1180177533 21:46097947-46097969 CGAGGGCGGGAGGCTGGAGGAGG - Intergenic
1180264220 21:46699310-46699332 CAAAGGCGGCGCGCCGGCGGAGG - Intergenic
1180707477 22:17818275-17818297 CGGTGGGGGCGGGCTGGAGGGGG + Exonic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1184086924 22:42270747-42270769 CGGGGGCGGGGCGCTGGGGGCGG + Intronic
1185302579 22:50090181-50090203 GGAAGGTGGCTCGCGGGAGGCGG + Exonic
1185430382 22:50807256-50807278 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
953727245 3:45410751-45410773 GTAAGGCGGAACGCTGGAGGAGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
961654277 3:128432913-128432935 CGCAGGTGGCGCGGGGGAGGGGG - Intergenic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
968075050 3:195811794-195811816 TGAAGGGGGCACGCTGGAGGAGG - Exonic
968879578 4:3292367-3292389 CGAAGGCGGCGCGGTGACTGCGG - Intergenic
971457879 4:26861089-26861111 CGGAGCCGGCGAGCTGCAGGCGG + Exonic
973279304 4:48342042-48342064 CGAGGGCGGCTTGCTGGACGAGG + Exonic
976184168 4:82429198-82429220 CGCGTGCGGCGCGCTGGGGGAGG + Intronic
981331409 4:143514035-143514057 CGAAGGCGTCGCGGCGCAGGCGG + Exonic
982292554 4:153793039-153793061 CTGAAGGGGCGCGCTGGAGGAGG + Intergenic
983537866 4:168877800-168877822 CGAGGGCGGCGCGCTGCGCGGGG - Intronic
985466789 4:190203974-190203996 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1002621964 5:180494426-180494448 CGAGGGGGGCGCGGAGGAGGAGG + Exonic
1002772538 6:302116-302138 CGATGGCGGGGTCCTGGAGGAGG - Intronic
1004709279 6:18155133-18155155 CGGAGGCGGGGCGCGGGCGGAGG - Intergenic
1004709286 6:18155150-18155172 CGGAGGCGGGGCGCGGGCGGAGG - Intergenic
1007176625 6:39901866-39901888 TGCAGGCAGCTCGCTGGAGGAGG + Exonic
1007631407 6:43275358-43275380 CGAAGGCGGGGCGACGGGGGCGG - Intronic
1015624437 6:135165800-135165822 TGAAGGTGGAGGGCTGGAGGAGG - Intergenic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019525874 7:1480256-1480278 CGAAGGCTGCACGCAGGAAGAGG + Intronic
1022336257 7:29424768-29424790 TGAAGGCAGCGCGGTGGACGAGG - Intronic
1022893768 7:34728344-34728366 CCAAGGAGGCATGCTGGAGGCGG + Intronic
1023221252 7:37921399-37921421 CGAGGGCGGCCTGCTGGCGGGGG + Intronic
1024920249 7:54546641-54546663 CGGATGCTGCGCTCTGGAGGCGG - Intronic
1027218861 7:76201725-76201747 CGAAGGGGGCGGGGAGGAGGGGG + Intergenic
1032011605 7:128351299-128351321 CGAAGGCAGGGCCCTGGAAGAGG + Exonic
1034166486 7:149028652-149028674 CGAGGGCCGCGCGCAGGAGTAGG - Intergenic
1034266423 7:149783271-149783293 CGAAGGCGTGGCGCTGGGAGTGG - Intergenic
1039476608 8:37842181-37842203 GGGCGGCGGCGCGCTGGAGAAGG + Exonic
1039873546 8:41567122-41567144 ATAAGGAGGCGCGCTGAAGGCGG - Intergenic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1049651509 8:143771905-143771927 CGAAGGCGGCGTCCAGCAGGCGG - Intergenic
1050090760 9:2015479-2015501 CGAAGGCGGCGTGGTGCCGGAGG - Intronic
1050306226 9:4308403-4308425 GGAAGGAAGGGCGCTGGAGGAGG + Intronic
1051287294 9:15510451-15510473 CGGAGGCAGCGCACTGGCGGGGG - Intronic
1053139872 9:35675825-35675847 AGAAGGCGGCGAGCTGGGGGCGG - Exonic
1054906554 9:70418725-70418747 AGAAGGAGGCGAGCTTGAGGAGG + Intergenic
1056746760 9:89310437-89310459 CGGAGCCGGCGCGGTGGCGGCGG - Intergenic
1056829700 9:89905878-89905900 GGAAGGGGGCGAACTGGAGGAGG + Intergenic
1056992361 9:91423759-91423781 CGAGGGCGCGGCGCGGGAGGCGG + Exonic
1060105291 9:120869309-120869331 GAAAGGCGGCGCGCTGAAGAAGG - Exonic
1060979962 9:127786124-127786146 CGGCGGCGGCGCGTTGGAGGCGG + Exonic
1061133439 9:128720793-128720815 AGAAGAGGGCGAGCTGGAGGGGG - Exonic
1061299687 9:129697516-129697538 CGAGCGCGCCGCGCTGGTGGCGG - Intronic
1061873944 9:133534761-133534783 GGGAGGCGGCGCGGGGGAGGAGG + Intronic
1062067435 9:134536257-134536279 CAGAGGCTGGGCGCTGGAGGGGG - Intergenic
1186888520 X:13938360-13938382 CGAAGCCGGGACGCTGGAGGTGG - Intronic
1192033928 X:67544200-67544222 CGAAGCCGCCGCGCTGCAAGAGG - Intronic