ID: 1064087054

View in Genome Browser
Species Human (GRCh38)
Location 10:12353030-12353052
Sequence GAAAGTACACAGAGGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064087054_1064087065 28 Left 1064087054 10:12353030-12353052 CCCAGCCGCCTCTGTGTACTTTC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 1064087065 10:12353081-12353103 GCTCCACCCTGGGCCATGACCGG No data
1064087054_1064087062 17 Left 1064087054 10:12353030-12353052 CCCAGCCGCCTCTGTGTACTTTC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 1064087062 10:12353070-12353092 TCAAGATGCCTGCTCCACCCTGG No data
1064087054_1064087063 18 Left 1064087054 10:12353030-12353052 CCCAGCCGCCTCTGTGTACTTTC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 1064087063 10:12353071-12353093 CAAGATGCCTGCTCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064087054 Original CRISPR GAAAGTACACAGAGGCGGCT GGG (reversed) Intronic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
900979842 1:6040137-6040159 GAAAGTACACAGATGCCCCCTGG + Intronic
901239166 1:7682874-7682896 GAACATACACAGAGTTGGCTGGG + Intronic
902415144 1:16234102-16234124 TAAATTACACAGAGGAGGCCTGG + Intronic
904261805 1:29291801-29291823 GACAGCACCCAGAGGTGGCTGGG - Intronic
904601641 1:31676027-31676049 CAAAGAACCCAGAGGAGGCTGGG + Intronic
908504661 1:64784445-64784467 GAAAGAACACATAGGCAGATAGG - Intronic
909615911 1:77607628-77607650 GAAAATACAGAGAGGAGGCCGGG + Intronic
911563560 1:99435505-99435527 GAAAGTAATTAGAGGCTGCTGGG + Intergenic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
917425150 1:174905553-174905575 GAAAATACACAGAGAAGTCTGGG + Intronic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
921148363 1:212380073-212380095 GAGAGTACACAGAGGCCTCTGGG + Intronic
924114121 1:240728899-240728921 GAAAGTTCAGAGAGGTGGCCGGG + Intergenic
1062874891 10:935064-935086 GAAAGGAAACACAGGGGGCTGGG - Intergenic
1062995230 10:1859263-1859285 GAAAGGATAAAGAGGAGGCTCGG - Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1067367613 10:45648971-45648993 AAAAGTACACAGACACGGCCGGG + Intronic
1068617754 10:59138280-59138302 GGACGGACACAGAGGCTGCTTGG + Intergenic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1070496904 10:77032952-77032974 GAAAATACAAAGAGGAGGTTTGG + Intronic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071963279 10:90827248-90827270 GAAAAGACACAGAGTAGGCTGGG + Intronic
1072926756 10:99622487-99622509 GAAAGGACATAGAGGTGGATAGG - Intergenic
1073524440 10:104166365-104166387 AAAAATACATAGAGGAGGCTGGG - Intronic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1075386452 10:122058877-122058899 AAAAACACACAGAGGGGGCTGGG - Intronic
1076345315 10:129775183-129775205 GAAAGTACCCAGAGGTGACGGGG + Intergenic
1077605697 11:3610016-3610038 GAAAGATCTCAGAGGTGGCTGGG - Intergenic
1081865385 11:46356943-46356965 GAAAGAGCAGAGAGGAGGCTGGG + Intronic
1089728590 11:120505094-120505116 GAAGTTACAGAGAGGCGGCCGGG - Intergenic
1091370997 11:135057718-135057740 GAAAAGACACAGAAGCTGCTGGG - Intergenic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1095744107 12:45638563-45638585 GAAAGTACACAGTGTTGCCTAGG - Intergenic
1095898647 12:47305643-47305665 GGAGGCACACACAGGCGGCTGGG - Intergenic
1096363831 12:51011449-51011471 GCATCTACACAGAGGCTGCTAGG + Intronic
1096640837 12:52993116-52993138 GAAAGTACATAGAGTAGGCTAGG + Intergenic
1097291686 12:57922028-57922050 GAAAAGACACAGAGTAGGCTGGG + Intergenic
1098097134 12:66970374-66970396 AAAATTACACAGATGAGGCTGGG - Intergenic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1100591161 12:96030767-96030789 GAAAGTACCCAGGGGCAGCTGGG - Intronic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1103900907 12:124303271-124303293 CAAAGTACACAGGGGCTCCTCGG - Intronic
1104246995 12:127053104-127053126 GAAATTACACAGAGGCCTGTAGG + Intergenic
1104493173 12:129212348-129212370 GGAAATACACAGAGGAGGCAGGG - Intronic
1105936459 13:25104799-25104821 GAAAATACAAAGAACCGGCTGGG + Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1108201061 13:48043662-48043684 GGAAGCACCCAGAGGTGGCTTGG - Intronic
1112786293 13:102955351-102955373 GAAAGTAGACAGGGGTGGCATGG - Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1121993922 14:98587014-98587036 GAAAGAATACAGAAGTGGCTTGG + Intergenic
1126065642 15:44824434-44824456 CAGAGCACACAGAGGCTGCTGGG - Intergenic
1126094193 15:45076133-45076155 CAGAGCACACAGAGGCTGCTGGG + Exonic
1126646262 15:50877732-50877754 AAAAGTACACAGAATCGGATGGG + Intergenic
1127486515 15:59422768-59422790 GAAACTAGATAGAGGTGGCTGGG - Intronic
1129387667 15:75204803-75204825 GAAAGTCCAGGGAGGTGGCTAGG - Intronic
1129447552 15:75629437-75629459 GTAAGATCACAGAGGCTGCTGGG + Intergenic
1131457425 15:92593404-92593426 GAAAGCACACAGAAGCAGCCAGG - Intergenic
1133110374 16:3544503-3544525 CTAAGCACACAGAGGCGTCTGGG + Intronic
1133706372 16:8358769-8358791 GAAAGTACCCAGAGACGTCCTGG + Intergenic
1135758564 16:25118208-25118230 GGAAGTACACAGAGCAGGCTGGG - Intronic
1141532937 16:84659296-84659318 GAAATTAAACAGAAGAGGCTGGG - Intronic
1141927339 16:87178202-87178224 GAAAGCACACAGAGGCTGAGAGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1144252683 17:13435585-13435607 GAAAGTACAGAGAAGCTGATAGG + Intergenic
1144486970 17:15674666-15674688 GCAAGAACAGAGAGGAGGCTGGG - Intronic
1144914059 17:18707634-18707656 GCAAGAACAGAGAGGAGGCTGGG + Intronic
1146627929 17:34448079-34448101 GACAGTACAAAGAGCCGGGTTGG - Intergenic
1147682122 17:42256374-42256396 GAAAGAAAAGAGAGGGGGCTGGG - Intronic
1149522675 17:57329803-57329825 GAACGGACACAGAGGCTCCTGGG + Intronic
1150335037 17:64324841-64324863 GAAAGTAGACAGTGGTTGCTAGG + Intronic
1151545305 17:74789236-74789258 GAAAGAACACAGGGGCCGGTGGG + Intronic
1154157409 18:11954686-11954708 AAAATTACACTGAGGCAGCTGGG - Intergenic
1155001101 18:21687504-21687526 GAAGTTTAACAGAGGCGGCTGGG - Intronic
1156309226 18:35907515-35907537 TAAAGAACACAGAGGCAGCTAGG + Intergenic
1158371464 18:56810703-56810725 GAGAGTACACTGAGGTGGCATGG + Intronic
1158641753 18:59209506-59209528 GATAGCACACAGGGGAGGCTGGG + Intergenic
1160383349 18:78477842-78477864 GACAGGACACAGGGGCTGCTAGG - Intergenic
1161195512 19:2984080-2984102 GAAAGCACAGCGAGGCGGCTGGG - Intronic
1163856323 19:19705021-19705043 CAAAGTACACACTGGCTGCTGGG + Intergenic
1164426578 19:28147086-28147108 GAAAATACAGAGAGATGGCTGGG - Intergenic
1164708461 19:30337501-30337523 GAAAGTACAGGGAGGCTGCTTGG - Intronic
1165215796 19:34271541-34271563 GAAAGTGCACAGAAGGGGCCGGG - Intronic
1166146995 19:40844823-40844845 GAAAGTACACAGGGGCTGGAGGG + Intronic
1166151153 19:40876719-40876741 GAAAGTACACAGGGGCTGGAGGG + Intronic
1166179154 19:41094885-41094907 GAAAGTACACAGGGGCTGCAGGG - Intronic
926038530 2:9654440-9654462 CACAGCACACAGAGGCAGCTAGG - Intergenic
926095321 2:10077812-10077834 GAAAATACATACAGTCGGCTGGG + Intronic
927199533 2:20569851-20569873 GAAAGTAGAGAGAGGCGGTGGGG - Intronic
927425459 2:22976627-22976649 GAAAGTATTCATAGGCTGCTTGG + Intergenic
927699448 2:25258670-25258692 GAAGGAACTCAGAGGCAGCTGGG + Intronic
927913054 2:26915122-26915144 GGAGGTGCACAGAGGTGGCTGGG - Intronic
928167325 2:28980644-28980666 GAAAGTACACATGGGCTGCTAGG + Intronic
929476984 2:42260459-42260481 AAAAAATCACAGAGGCGGCTGGG - Intronic
930528598 2:52563003-52563025 GAAAGAAAACAGAAGTGGCTGGG + Intergenic
935131013 2:100261031-100261053 GAGAGGCAACAGAGGCGGCTTGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
940284471 2:152020060-152020082 GAATGTACACATAGGCTGCAGGG - Intronic
942583983 2:177453980-177454002 AAAAGTAGCCAGAGGGGGCTGGG - Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
945067828 2:205961957-205961979 GAAAGTGCACAGACGGGCCTAGG - Intergenic
946229903 2:218284793-218284815 GAAAATACACATAGAAGGCTGGG + Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
946599495 2:221343976-221343998 GAAATTACACAAGGGCGGCCAGG + Intergenic
948845359 2:240680412-240680434 CAAAGGTCACAGAGGCGGCCAGG + Exonic
948848502 2:240694467-240694489 CAAAGGTCACAGAGGCGGCCAGG - Exonic
1170501602 20:16980228-16980250 GAAATTACTCTGAGGAGGCTTGG + Intergenic
1172085073 20:32375134-32375156 TAAAGTGCTCAGAGGTGGCTGGG - Intronic
1173022901 20:39282971-39282993 AACAGTATGCAGAGGCGGCTGGG - Intergenic
1173288986 20:41697851-41697873 CAAAGCACACAGAGGGGGCCCGG + Intergenic
1176222056 20:63974425-63974447 CAAAGCACACAGAGGGGACTAGG + Exonic
1178578138 21:33813646-33813668 GAAAGAACAAGGAGGAGGCTGGG - Intronic
1179821948 21:43942212-43942234 GGAGGGCCACAGAGGCGGCTTGG + Intronic
1179989507 21:44939925-44939947 GGAAGTACCCGGAAGCGGCTCGG - Intergenic
1180676075 22:17587372-17587394 GGAAGGACACAGAGGCAGATAGG - Intronic
1183766615 22:39882707-39882729 GAAAATACACAAAGAGGGCTGGG + Intronic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
950124533 3:10503347-10503369 GAAAGGAGACAGAGGCGGCCAGG - Intronic
952553599 3:34506977-34506999 AAAAGTTCAGAGAGTCGGCTGGG + Intergenic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
953345862 3:42174860-42174882 GAAATAACACAGAGGGGGCCGGG - Intronic
953681958 3:45046153-45046175 CAAAGCACACAGAGGAGACTGGG + Intergenic
953889220 3:46738242-46738264 GAAAGTAAAAAGATGTGGCTGGG + Intronic
954892495 3:53944013-53944035 GGAGGTACACAAAGGCGGCCTGG + Intergenic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
956606505 3:71078125-71078147 GAAAATATACAGAGGAGGCCGGG - Intronic
956612368 3:71137140-71137162 AAAAGAACTCAGAGGCCGCTAGG - Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
957010326 3:74997748-74997770 GAAAGAACACAGAAACGGCCGGG - Intergenic
959320839 3:104873103-104873125 GAAAGGAGACAGTGGTGGCTTGG + Intergenic
960934858 3:122892532-122892554 GTAAGGAAGCAGAGGCGGCTGGG + Intergenic
961539352 3:127589729-127589751 GTAAATACCCAGACGCGGCTCGG - Intronic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
963980915 3:151536062-151536084 GACAGGACACAGTGGCAGCTAGG - Intergenic
964639682 3:158895239-158895261 GAAACTTCACTGAGGTGGCTGGG + Intergenic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
967944802 3:194795593-194795615 GAAAGCACACAAAAGAGGCTGGG - Intergenic
968057849 3:195706327-195706349 GAAATTAGACAGAGGTGGCCAGG - Intergenic
969150886 4:5167547-5167569 GAAAGAACACAGAGAAGGGTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
978312587 4:107401474-107401496 GAAAATACACACAGAAGGCTGGG + Intergenic
979928840 4:126603989-126604011 GAAAGTACAGAGAGGTGGGGTGG - Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
981049805 4:140298615-140298637 GAAAGAACTCAGAGGCTGGTGGG - Intronic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
982932053 4:161421044-161421066 GAAAGTACTCAGTAGAGGCTGGG + Intronic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
984732961 4:183085418-183085440 GAAAGTACAAATAAGCGGCCGGG - Intergenic
985869205 5:2540615-2540637 AAAAGGACACAGAGTGGGCTTGG - Intergenic
985945087 5:3175662-3175684 CAAAGCACACAGAGCAGGCTAGG - Intergenic
989989876 5:50749497-50749519 GTAAGTACATAGAGGCAGCAGGG + Intronic
990350211 5:54908577-54908599 GACAATACACAGTGGTGGCTTGG - Intergenic
990504277 5:56429339-56429361 GGAAGTATACTGAGGCGTCTGGG + Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
993668449 5:90730150-90730172 TAAAATACCCAGAGTCGGCTGGG - Intronic
995130804 5:108628510-108628532 AAAAGAACACAGAGTCAGCTAGG + Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
996779781 5:127172644-127172666 CCAAGCACACAGAGGCGGCCTGG - Intergenic
999417884 5:151415807-151415829 GAAAGTACACAGAGTCAGGCTGG + Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1002198593 5:177514291-177514313 GAAAGGACACAGGTGCCGCTGGG + Intronic
1007768257 6:44173877-44173899 GAAAGTAAACAGGGCTGGCTGGG - Intronic
1008953004 6:57181394-57181416 AGAAGTACACATAGGGGGCTGGG + Intronic
1009277810 6:61706163-61706185 GAGAGTACACAGGGAGGGCTGGG - Intronic
1011892642 6:92185973-92185995 GAGAGTACACAGAAGATGCTTGG + Intergenic
1013555426 6:111252379-111252401 GATAGTACCAAGGGGCGGCTTGG + Intergenic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1016059107 6:139610155-139610177 GAAAGTAGACCTAGGAGGCTTGG - Intergenic
1020021953 7:4874480-4874502 GAAGGTTCACTGAGGCGGCCGGG - Intronic
1020256407 7:6504885-6504907 GACAGTTTACGGAGGCGGCTAGG + Intronic
1023148525 7:37177343-37177365 GAAAGTACAAAGAAGTGGCATGG + Intronic
1026351186 7:69516834-69516856 AAAAGTACACAAACGTGGCTGGG + Intergenic
1026436881 7:70406854-70406876 TACTGTACACAGATGCGGCTGGG - Intronic
1028530305 7:91831413-91831435 GAAAGAATACAGAGGTGGTTAGG + Intronic
1028606325 7:92660339-92660361 GAAAGATGACAGAGGCAGCTGGG + Intronic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1038431684 8:27505406-27505428 GTAAGTAAACTGAGGCAGCTGGG - Intronic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1040082020 8:43295027-43295049 GAAAGTTCACAGAAGAGGCCAGG - Intergenic
1040511332 8:48098917-48098939 GAAAATACACAGAGAAGGCTGGG - Intergenic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1049582110 8:143417532-143417554 GAAAATAGACAGGGGAGGCTGGG + Intergenic
1050537885 9:6645784-6645806 GAAAGTAGACAGAGGGGGAGGGG + Intergenic
1050583901 9:7090013-7090035 TCAAGTACAAAGAGGAGGCTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1060931412 9:127491707-127491729 GGAGTTACACAGATGCGGCTGGG - Intronic
1186268576 X:7859392-7859414 TAAAGGACACAGAGGCGTTTTGG + Intergenic
1189786954 X:44567814-44567836 AAGAGTACACAGAGGAGGCCGGG + Intergenic
1192454099 X:71263167-71263189 TAAAGTACCCAGTGGGGGCTGGG + Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1196614685 X:117754511-117754533 GAAAGTCCACAGAGGAGCCTGGG - Intergenic