ID: 1064087988

View in Genome Browser
Species Human (GRCh38)
Location 10:12359949-12359971
Sequence ACACTAACATCCTGTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064087988 Original CRISPR ACACTAACATCCTGTGACCT GGG (reversed) Intronic
902546405 1:17193326-17193348 ACACTTACGCCCTGTGTCCTGGG - Intergenic
905935729 1:41822576-41822598 ATACTTGCATCCTGAGACCTAGG - Intronic
906456513 1:46001836-46001858 ACACTAAGATCCTGAGATTTGGG - Intronic
907093946 1:51757765-51757787 CCACTCACTACCTGTGACCTTGG + Intronic
907324517 1:53628250-53628272 ACACTAAAATGCTGTCATCTGGG - Intronic
909494253 1:76260574-76260596 CGACTTACTTCCTGTGACCTTGG - Intronic
909607053 1:77518268-77518290 TCACTAACTGCCTGTGACCATGG + Intronic
912634233 1:111277050-111277072 CCACTAACATGCTGTGGCTTTGG - Intergenic
912661469 1:111534981-111535003 ATACTAATTTCCTGTGAGCTGGG - Intronic
913586250 1:120278178-120278200 ACCTTAACAACCTGTGACCTTGG + Intergenic
913621936 1:120620191-120620213 ACCTTAACAACCTGTGACCTTGG - Intergenic
914568259 1:148890036-148890058 ACCTTAACAACCTGTGACCTTGG + Intronic
914604566 1:149240213-149240235 ACCTTAACAACCTGTGACCTTGG - Intergenic
917061217 1:171042684-171042706 ACAATGACATCCTGTCACCCCGG - Intronic
921709695 1:218361435-218361457 ACACAGACTTCCTATGACCTGGG + Intronic
922401707 1:225265667-225265689 ACACTTTCTTCCTGTGACCATGG + Intronic
923887191 1:238171566-238171588 ACATTTACATCCTGTTTCCTTGG + Intergenic
924084709 1:240438975-240438997 AAACTTACATCCTGTGAGCCAGG + Intronic
1063481988 10:6384324-6384346 ACACTAACCTCACGTGACGTGGG - Intergenic
1064087988 10:12359949-12359971 ACACTAACATCCTGTGACCTGGG - Intronic
1064248710 10:13690515-13690537 ACACCCACCTCCTGTGACTTAGG - Intronic
1066537599 10:36408529-36408551 ACAGTAACATGCTGTACCCTAGG + Intergenic
1067428346 10:46226062-46226084 TCACTAATATTTTGTGACCTTGG - Intergenic
1067494835 10:46752508-46752530 ACACTACCTGCCTGTGAACTGGG - Intergenic
1070809076 10:79288540-79288562 ACACACACACCCTGTGCCCTGGG + Intronic
1070882103 10:79859669-79859691 ACACTCACATTCTGGGACCAGGG + Intergenic
1071648678 10:87375980-87376002 ACACTCACATTCTGGGACCAGGG + Intergenic
1071651356 10:87395772-87395794 ACACTACCTGCCTGTGAACTGGG + Intergenic
1071967156 10:90863477-90863499 GCACCAACATCCTGAGATCTTGG + Intergenic
1074167875 10:110901745-110901767 CCATTAATTTCCTGTGACCTTGG + Intronic
1075120334 10:119659968-119659990 AAGCTAACTTCATGTGACCTTGG + Intronic
1076531842 10:131150166-131150188 AGAACAACTTCCTGTGACCTGGG + Intronic
1078498786 11:11848324-11848346 ACAGTAACATGCTGTAGCCTAGG - Intronic
1078614961 11:12856382-12856404 ACATTCACAGCCTTTGACCTGGG - Intronic
1079043618 11:17080668-17080690 ACACAGACATCCTGTAATCTGGG - Intronic
1088812602 11:113401651-113401673 ACACTAACTTTATGTGACCAGGG + Intergenic
1089080308 11:115770892-115770914 ACACTTCCAGCCTGTAACCTCGG - Intergenic
1090361877 11:126178451-126178473 GCACTACCATCCTTTAACCTGGG - Intergenic
1092302597 12:7266365-7266387 TCACAAAAATCCTGTGAACTAGG - Intergenic
1093765023 12:22952829-22952851 ACACTAGCTTCCTGACACCTTGG - Intergenic
1095656786 12:44679525-44679547 TCACAATCATCCTGTGACCTGGG + Intronic
1100279156 12:93101638-93101660 CCACTAACCAGCTGTGACCTCGG - Intergenic
1100496722 12:95132116-95132138 ATACCAACATCATGTGAGCTTGG - Intronic
1103200068 12:119080900-119080922 ATGTTAACATCATGTGACCTTGG - Intronic
1106668709 13:31881566-31881588 AGACTACAATACTGTGACCTTGG - Intergenic
1108418846 13:50228411-50228433 AGACTACCATCATGTGTCCTGGG + Intronic
1113460371 13:110478324-110478346 ACACAAACAGCCTGAGACATCGG + Intronic
1113503456 13:110796454-110796476 ACATTAACATAGGGTGACCTTGG + Intergenic
1116694357 14:48152972-48152994 CTACTAACATACTATGACCTAGG - Intergenic
1118470165 14:66067857-66067879 ACACCCCCAGCCTGTGACCTGGG - Intergenic
1121981053 14:98454179-98454201 AAAGTAACATCCTGAAACCTTGG - Intergenic
1122182263 14:99964538-99964560 ACACCAACTTACTGTGACCTGGG + Intergenic
1127825497 15:62699093-62699115 ACCCTAGGATCCTGTGACCTGGG + Intronic
1129029509 15:72608280-72608302 AGACCCACATCCTGTGTCCTTGG + Intergenic
1133681758 16:8126507-8126529 ACACTAGCATCATGTGACCAAGG + Intergenic
1135686925 16:24505244-24505266 ACACACACATCCTGTGACAAAGG + Intergenic
1136712980 16:32254635-32254657 ACACTAAGACCCTGAGGCCTGGG - Intronic
1136748392 16:32612386-32612408 ACCCTATTCTCCTGTGACCTTGG - Intergenic
1136754936 16:32674803-32674825 ACACTAAGACCCTGAGGCCTGGG + Intronic
1136813177 16:33195566-33195588 ACACTAAGACCCTGAGGCCTGGG - Intronic
1136819653 16:33305646-33305668 ACACTAAGACCCTGAGGCCTGGG - Exonic
1136826216 16:33362181-33362203 ACACTAAGACCCTGAGGCCTGGG - Intronic
1136831282 16:33460952-33460974 ACACTAAGACCCTGAGGCCTGGG - Exonic
1141492453 16:84383296-84383318 ACACTCACCTGCCGTGACCTTGG + Intronic
1202991753 16_KI270728v1_random:18536-18558 ACACTAAGACCCTGAGGCCTGGG - Intergenic
1203050527 16_KI270728v1_random:871591-871613 ACCCTATTCTCCTGTGACCTTGG - Intergenic
1203057077 16_KI270728v1_random:935133-935155 ACACTAAGACCCTGAGGCCTGGG + Intergenic
1142623028 17:1177030-1177052 ACACTGCCACCCTGTGCCCTGGG + Intronic
1145005975 17:19338012-19338034 ACAGTAAGGTCCTGTGTCCTGGG + Intronic
1146214629 17:30969489-30969511 AAACCATCATCCGGTGACCTGGG - Intronic
1150946778 17:69755238-69755260 CCAATAACATCCTGAGACCCAGG + Intergenic
1156266481 18:35493072-35493094 ACACTAACACTGTGTGAGCTTGG + Intronic
1157608770 18:48942861-48942883 ACCCAAACCTCCTTTGACCTTGG - Intronic
1158020273 18:52833491-52833513 ACAGTCTCATCCTGTCACCTAGG + Intronic
1158387689 18:57013546-57013568 ACACTTACATCATATCACCTGGG - Intronic
1166602500 19:44110408-44110430 CCACTAAAACCCTGTGACCCCGG + Intergenic
1167850760 19:52199773-52199795 ACACTAACAATCACTGACCTGGG - Intronic
928331493 2:30361127-30361149 ACACTCACATTTTGTTACCTGGG + Intergenic
929028535 2:37629071-37629093 CAACTACCATTCTGTGACCTTGG - Intergenic
930692411 2:54378153-54378175 ACTTTATCATCCTGTTACCTGGG + Intronic
933608072 2:84405062-84405084 AAAGTGACATCCTGTCACCTTGG - Intergenic
936248150 2:110846391-110846413 TCACTAAAATCCTGTACCCTTGG + Intronic
936998895 2:118443810-118443832 AAGCTAACAGCCTATGACCTAGG - Intergenic
942469789 2:176248299-176248321 ACACTAACAGTCTATGATCTTGG + Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946407274 2:219498364-219498386 ACTCCAACAGGCTGTGACCTTGG - Intergenic
947070619 2:226283960-226283982 ACACTTACATCCTGTGAAAAAGG + Intergenic
1168870272 20:1121576-1121598 ACACAAATATCCTCTGAGCTTGG - Intronic
1169892384 20:10467132-10467154 TCACTTAAATCCTGTGTCCTAGG + Intronic
1170614050 20:17934983-17935005 ACAGTTACATCCTGTGAGCCGGG - Intergenic
1170949338 20:20921837-20921859 ACACTCACCTGCTGTGACCTGGG + Intergenic
1171032911 20:21693038-21693060 CCACTTGCATCCTGTGACCCAGG - Intergenic
1174838386 20:53879131-53879153 ACACTACCGTCCTGGGAGCTAGG + Intergenic
1174838499 20:53879937-53879959 ACACAACCATCCTGGGAGCTAGG - Intergenic
1177203432 21:17983349-17983371 ATACATACATCTTGTGACCTTGG + Intronic
1178441176 21:32599658-32599680 CCACTAGCTACCTGTGACCTTGG + Intronic
1178580428 21:33833454-33833476 CCACTAACTGCCTGTGGCCTTGG + Intronic
1179625150 21:42645062-42645084 ACACTTCCTTCCAGTGACCTGGG - Intergenic
1181744691 22:24947865-24947887 AGACCTACATCCTGTGTCCTAGG + Intergenic
1181873373 22:25921136-25921158 CCACTCACACCGTGTGACCTTGG - Intronic
1182478130 22:30587948-30587970 CCACTAACTAACTGTGACCTTGG - Intronic
1184649989 22:45915300-45915322 ACACTTTCCTCCTGGGACCTAGG + Intergenic
1184777300 22:46629580-46629602 CCAGAAACATCCTGAGACCTGGG + Intronic
1185413232 22:50696908-50696930 ACTCTAACATCCTGACCCCTGGG - Intergenic
949312954 3:2720814-2720836 ACACTTACATCCTATAAACTGGG + Intronic
953141817 3:40236194-40236216 ACAGTAACATGCTGTAGCCTAGG + Intronic
953744517 3:45563835-45563857 ATACAATTATCCTGTGACCTAGG - Intronic
955655047 3:61236547-61236569 TCTCCAACATTCTGTGACCTGGG - Intronic
956487074 3:69734178-69734200 ACCCTAACATCCTGTTTCCTTGG + Intergenic
956921401 3:73933601-73933623 AAAGTAACATTCTGTGATCTAGG + Intergenic
960723612 3:120648682-120648704 AAACTCACACACTGTGACCTGGG + Intronic
961566739 3:127769488-127769510 ACACTAAAACCCTGTGACGGAGG + Intronic
963826568 3:149961400-149961422 ACACTTAAATACTGTGATCTAGG - Exonic
966480310 3:180400850-180400872 ACAATAACTTCCTGTGACTGGGG - Intergenic
970024212 4:11604636-11604658 ACACTAGCCTCCTCAGACCTTGG + Intergenic
970751142 4:19363424-19363446 ACACTACTATCCTTTGAACTGGG - Intergenic
971375990 4:26056229-26056251 CCACCAACAGCCTGGGACCTAGG + Intergenic
975314800 4:72939386-72939408 ACACTTAGATCATATGACCTTGG + Intergenic
980113903 4:128660986-128661008 ACTCTAACATTCTGTGACTCTGG - Intergenic
982100457 4:151962147-151962169 AAACTAACATCCTTTGTCTTAGG - Intergenic
982257533 4:153465846-153465868 CCACTAATATCCTGTGTCCAAGG + Intergenic
983764359 4:171459031-171459053 ACACAAACATGCTGTAATCTAGG + Intergenic
984149754 4:176112241-176112263 CCACTCACATCCCGTGCCCTTGG + Intronic
988702544 5:33689743-33689765 ACCCAAACCACCTGTGACCTTGG + Intronic
989155789 5:38343600-38343622 AAAATAACTTCCTGTGACCAGGG + Intronic
993415722 5:87627666-87627688 ACATTAACATACTTTGAGCTGGG - Intergenic
995702524 5:114952455-114952477 ACAGTAACATGCTGTAGCCTAGG - Intergenic
1000419760 5:161025347-161025369 CCACCAAAATCCTGTTACCTGGG + Intergenic
1001990265 5:176110774-176110796 ACCCTATTCTCCTGTGACCTTGG - Intronic
1002226607 5:177727366-177727388 ACCCTATTCTCCTGTGACCTTGG + Intronic
1002267237 5:178043847-178043869 ACCCTATTCTCCTGTGACCTTGG - Intronic
1002587322 5:180257613-180257635 AGACTGTCACCCTGTGACCTTGG + Intronic
1005687689 6:28271040-28271062 TCACTTACATGTTGTGACCTGGG - Intronic
1009318393 6:62253710-62253732 ACAATAACAGCCTGTGTCCCTGG + Intronic
1011864111 6:91800196-91800218 ACAATAAAATCCCATGACCTTGG - Intergenic
1013876076 6:114830384-114830406 ACACTCCCAGCCTTTGACCTTGG - Intergenic
1015383664 6:132598547-132598569 ACACTCACATCCTAGGAACTTGG + Intergenic
1017587893 6:155947150-155947172 ACACCAACACCCTGCCACCTTGG + Intergenic
1018521911 6:164658368-164658390 ACAGTAAAATCATGTGGCCTTGG + Intergenic
1020288086 7:6701313-6701335 ACACTAACATCATTTGTCTTGGG - Intronic
1020822654 7:12989370-12989392 ACAATAACATGCTCTAACCTGGG + Intergenic
1022666627 7:32416888-32416910 ACAGTAAAAAGCTGTGACCTTGG + Intergenic
1022667981 7:32428955-32428977 CCACTAACTGCCTATGACCTTGG - Intergenic
1023994441 7:45150625-45150647 ACACTAAAGTCCTGAGTCCTGGG + Intergenic
1029880580 7:103805220-103805242 ACAGTAGCATCCTGTGAGATAGG - Intronic
1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG + Intronic
1030785119 7:113650583-113650605 ACACTAATATCCTATTACATAGG - Intergenic
1031648418 7:124255552-124255574 AAATTAACATGCTGTCACCTAGG + Intergenic
1032840948 7:135713118-135713140 AGACTCACATCCTGTGAGCTGGG + Intronic
1033262487 7:139855728-139855750 GGACTAACTTCCTCTGACCTAGG + Intronic
1035428073 7:158795438-158795460 ACACGAACATGCTGTAACTTAGG + Intronic
1035740929 8:1928053-1928075 ACACTAATATTCAATGACCTAGG - Intronic
1037175423 8:15941343-15941365 GCACCAACATCCTGTCTCCTCGG + Intergenic
1037600461 8:20389629-20389651 AAACAAACCCCCTGTGACCTAGG + Intergenic
1039875717 8:41583652-41583674 CCACTAACCACGTGTGACCTTGG - Intronic
1039979388 8:42394221-42394243 ACACCAACGTACTGTGACCTAGG + Exonic
1043210116 8:77503497-77503519 ACACTAAACTCCTGGGAACTTGG + Intergenic
1045265680 8:100616977-100616999 ACACTCACATCCTGCTGCCTGGG - Intronic
1046020015 8:108653488-108653510 ACAAGTACATCCTGTGAACTAGG - Intronic
1046127812 8:109932058-109932080 AGACTCACATCCTCTGACATTGG + Intergenic
1048875841 8:138836615-138836637 ACACCAATATCCTGTGATCCTGG + Intronic
1051494724 9:17707148-17707170 ACACACACATGTTGTGACCTTGG + Intronic
1055759706 9:79593945-79593967 CCAGTAACTTCCTGTGACATTGG + Intronic
1056642698 9:88385032-88385054 GCACTAACATCCTAAGAACTAGG + Intergenic
1057474287 9:95385522-95385544 ACAATGATATCCTGGGACCTAGG - Intergenic
1057490037 9:95513498-95513520 TCACTCACATCCTGTATCCTGGG - Intronic
1057741834 9:97718829-97718851 ACACTATTAGCCTCTGACCTGGG - Intergenic
1058399809 9:104602237-104602259 TCTCTAAAATCCTGTGATCTGGG - Intergenic
1058970427 9:110077403-110077425 ACTTTAACATCTTGTGACGTGGG + Intronic
1059978477 9:119743413-119743435 ACAACAATATCCTGTGACATAGG - Intergenic
1060028403 9:120192542-120192564 GCAGTAAAATCCTGAGACCTTGG + Intergenic
1186241516 X:7572730-7572752 ACACTTATTTCTTGTGACCTAGG - Intergenic
1187637850 X:21251986-21252008 ACACTAACATTCTCTGTCCTTGG - Intergenic
1191937462 X:66440700-66440722 ATTCTAGCAACCTGTGACCTTGG + Intergenic
1192534860 X:71918572-71918594 ACGTTAACATCCTCTGTCCTTGG + Intergenic
1196607512 X:117672799-117672821 ACTCTGACACCATGTGACCTTGG + Intergenic