ID: 1064090067

View in Genome Browser
Species Human (GRCh38)
Location 10:12375660-12375682
Sequence ACCCTAGGACACAGGCAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064090067_1064090075 18 Left 1064090067 10:12375660-12375682 CCCGATTGCCTGTGTCCTAGGGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1064090075 10:12375701-12375723 ACTCTATTATTTCCTCGTTGGGG No data
1064090067_1064090074 17 Left 1064090067 10:12375660-12375682 CCCGATTGCCTGTGTCCTAGGGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1064090074 10:12375700-12375722 TACTCTATTATTTCCTCGTTGGG No data
1064090067_1064090073 16 Left 1064090067 10:12375660-12375682 CCCGATTGCCTGTGTCCTAGGGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1064090073 10:12375699-12375721 TTACTCTATTATTTCCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064090067 Original CRISPR ACCCTAGGACACAGGCAATC GGG (reversed) Intronic
900079815 1:847516-847538 ACCCTAGGACATGAGCAACCTGG + Intergenic
902975223 1:20083504-20083526 ATCCTAGGAGGAAGGCAATCAGG + Intronic
903679570 1:25088151-25088173 CCCCTAGGTCACAGCCAAGCTGG + Intergenic
903811596 1:26037760-26037782 TACCTAGAACACAGGCGATCAGG + Intronic
904988737 1:34574044-34574066 ACCCTGGGAGGCAGGCAATAGGG + Intergenic
906790304 1:48653401-48653423 CCCGGAGGACACAGGCAATAGGG + Exonic
909913625 1:81291083-81291105 AGCCTAGGACAAAGAAAATCAGG - Intergenic
910240390 1:85079879-85079901 ACCCTTGGACACAGGAAAGTGGG - Intronic
910775453 1:90870337-90870359 TCCCTAACACACATGCAATCAGG + Intergenic
911305433 1:96226144-96226166 TTCCCAGAACACAGGCAATCAGG + Intergenic
912843342 1:113058674-113058696 TGCCTGGAACACAGGCAATCAGG + Intergenic
921215254 1:212931407-212931429 GCCCTAATACAAAGGCAATCTGG + Intergenic
922506649 1:226130014-226130036 ACCCTGGGAGACAGCCAATTGGG + Intergenic
1062958245 10:1554172-1554194 AGCCTAGGGCACAGGCCACCCGG - Intronic
1064090067 10:12375660-12375682 ACCCTAGGACACAGGCAATCGGG - Intronic
1065241541 10:23709811-23709833 ACCCAAGGTCACAGGCAGTTGGG + Intronic
1065834985 10:29648792-29648814 AACCTAGGACACAGGACAGCTGG + Intronic
1068549063 10:58385654-58385676 CCCCTAGGGCACAGGCAAGCGGG - Intronic
1072618890 10:97067136-97067158 AGCCTAGGCCACAGGGAGTCAGG + Intronic
1082959258 11:58903269-58903291 CACCTAAGACACAGGGAATCTGG + Intronic
1084962513 11:72724714-72724736 ACCCCAGGACACAGGAAGCCAGG + Intronic
1085270945 11:75269441-75269463 ACCCTAGCACCCCTGCAATCTGG + Intronic
1086965985 11:93028682-93028704 TCCCAAGGCCACAGGCAATCAGG - Intergenic
1087166681 11:95012135-95012157 ACCCACGGCCACAGGCAAACTGG - Intergenic
1089119740 11:116125115-116125137 ACCCCTGGGCACAGGCAAGCCGG + Intergenic
1093006986 12:14061622-14061644 ACCCTGAGACACAGGCTGTCAGG + Intergenic
1104414633 12:128588042-128588064 ACCCTAGGACAGAGGCACTTTGG + Intronic
1105417262 13:20224147-20224169 GCCCTAGGAGAAAGCCAATCTGG - Intronic
1109347202 13:61128386-61128408 TCCCTAGGAAACAGAAAATCAGG + Intergenic
1109413724 13:62008274-62008296 ACCTTAGAACACAGGACATCTGG - Intergenic
1117384762 14:55200556-55200578 TTCCAAGGAAACAGGCAATCAGG + Intergenic
1117635531 14:57739288-57739310 ACTCCAGGACTCAGGCATTCAGG + Intronic
1118871278 14:69744671-69744693 AACCTAGTCCACAGGCAATGAGG - Intronic
1121879033 14:97483254-97483276 ACTGTATGAAACAGGCAATCAGG + Intergenic
1122853404 14:104548580-104548602 ACCCCAGGACTCAGGCCATGGGG - Intronic
1124815547 15:32988147-32988169 ACAGTAGGACATAGTCAATCTGG + Intronic
1129195716 15:73965035-73965057 ACCCTAGTACACAGGCTCTGCGG - Intergenic
1129789023 15:78328460-78328482 ACCATAGGGCCCAGACAATCAGG + Intergenic
1130699553 15:86164893-86164915 CCCCAAGGACACAGGAAGTCAGG + Intronic
1137759817 16:50931393-50931415 ACCCTATGAAACAGGCAAGTTGG + Intergenic
1138386841 16:56641323-56641345 ACCCAAGGACACTGAAAATCTGG - Intronic
1138819166 16:60238061-60238083 AAGCTATGACACAGGCAAGCTGG - Intergenic
1140907117 16:79418371-79418393 AACGTAGGACACAGGTATTCAGG - Intergenic
1147018352 17:37510638-37510660 AGGCAAGGACACAGCCAATCAGG - Intronic
1148452328 17:47787699-47787721 ACCCCTGGACTCAAGCAATCGGG - Intergenic
1152000873 17:77644658-77644680 GTCCAAGGACACAGGCCATCTGG + Intergenic
1152744511 17:82032632-82032654 ACCCCAAGACACAGGCCAGCAGG + Intronic
1153786953 18:8543792-8543814 GCCCTTGGACCCAGGCAATGGGG - Intergenic
1154160372 18:11976903-11976925 ACCCTAGGGCACAGTCCTTCTGG - Intergenic
1166300742 19:41910800-41910822 ACACTGGGACACAGGCACACCGG + Intronic
1168255959 19:55165498-55165520 CTCCTAGGACCCAGGCAAACAGG - Intronic
937454484 2:122029566-122029588 ACCCTGGGCCACAGTCAAACTGG - Intergenic
938290097 2:130144523-130144545 GCCCTAGGAGACAGGCAGACAGG + Intronic
941157347 2:161995657-161995679 TGCATAGGACACAGCCAATCTGG - Intronic
949023797 2:241755534-241755556 ACCCTGGGACTCCGGCAATCAGG - Intronic
1168951522 20:1805191-1805213 ATCCTTGGACCCAGGCAAGCGGG + Intergenic
1170737331 20:19023203-19023225 ACCCATGGACGCAGGCACTCTGG + Intergenic
1171299813 20:24050367-24050389 AGGCTGGGACACAGGCAATGAGG + Intergenic
1175481127 20:59311850-59311872 ACACAAGGACACAGACAATTAGG + Intronic
1179239951 21:39581210-39581232 TCCCTAGGACACAGGCCTTCAGG - Intronic
1182079488 22:27518842-27518864 TGCCTAGGATACAAGCAATCGGG + Intergenic
1182583258 22:31327959-31327981 ACCCTAGGCCCCAGACAAGCTGG + Intronic
1183960025 22:41405866-41405888 ACACTGAGACACAGGCACTCGGG - Intergenic
950628607 3:14266716-14266738 ACCCAAGGTCAGAGGCAATTAGG - Intergenic
954389650 3:50261881-50261903 ACCCTAGGAGTCAGGGAGTCAGG + Intergenic
954905402 3:54058494-54058516 ACCCAGGGACAAAGCCAATCGGG - Intergenic
960142301 3:114162897-114162919 ACCCTGGGATAGAGGCAATCAGG - Intronic
960164024 3:114381464-114381486 ACCCTAGACCACAGCCAAACTGG + Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960377416 3:116920346-116920368 ACCCTAGGACATAGGCTTTATGG - Intronic
961591463 3:127984727-127984749 ACCCTGTGCCCCAGGCAATCTGG - Exonic
967226266 3:187294345-187294367 ACCCAAGGTCACATGCAAGCTGG - Intergenic
967375712 3:188798188-188798210 ATCCTATGAAACGGGCAATCTGG + Intronic
967529402 3:190531777-190531799 TCCCTAGGGCACATGAAATCGGG + Intronic
968295784 3:197575545-197575567 AACCTATAACACAGGCAAGCTGG + Intergenic
969119997 4:4901081-4901103 GCCCAAGGACACAGGGAATCAGG - Intergenic
977904217 4:102456929-102456951 ACCCAAAGGCACAGGCACTCTGG + Intergenic
979167103 4:117548484-117548506 AACCTCTGACCCAGGCAATCAGG + Intergenic
980794497 4:137663371-137663393 ACCCTAGGATGGATGCAATCAGG - Intergenic
981278411 4:142928869-142928891 ACCAAAGGACAAAGGCAAACTGG + Intergenic
983924622 4:173386699-173386721 ACCATACCACACAGGCAATCTGG - Exonic
995544104 5:113213141-113213163 ACCCTAGGAAAGAGGCAAATAGG - Intronic
997957662 5:138292527-138292549 ATCCTAGGACATTGACAATCAGG + Intronic
999006002 5:147979961-147979983 GCCCTAGGTCACACCCAATCAGG - Intergenic
1001308223 5:170591197-170591219 AGCCTAGGACTCAGGGAAGCAGG - Intronic
1006213645 6:32419516-32419538 ATCAAATGACACAGGCAATCTGG + Intergenic
1008692758 6:53999456-53999478 AAGCTATGACACAGGCAAGCTGG + Intronic
1022472703 7:30691495-30691517 CCCCCAGGACTCAGGCAATGTGG + Intronic
1026564922 7:71481780-71481802 ACCCAAGGTCAGAGGCAATAAGG + Intronic
1035525689 8:311400-311422 ACCCTAGGACATGAGCAACCTGG - Intergenic
1038445917 8:27604236-27604258 ACCCCAGGACACAAGGGATCAGG + Intronic
1039404032 8:37297495-37297517 ACCCCAGGACTCAGGAAGTCTGG + Intergenic
1039532946 8:38280521-38280543 AGCCTAGAACACAGGAAATATGG + Intronic
1041715169 8:60925706-60925728 AGCCTGGGAGACAGGCAATAAGG + Intergenic
1043437119 8:80245603-80245625 ACTCTTGGACTCAAGCAATCCGG - Intergenic
1045318547 8:101063863-101063885 ACCCTAGGCCTCAGGCACCCTGG - Intergenic
1047246968 8:123154618-123154640 ACCCTCAGGCACAGGCAAACAGG + Intergenic
1048419995 8:134268743-134268765 ACTCTAGGACACACCCATTCAGG + Intergenic
1051156781 9:14156785-14156807 ACCCTAGGACAGAAGCAAGTAGG - Intronic
1053803991 9:41783522-41783544 ACCCAAGCACACAGGCACACGGG + Intergenic
1054192294 9:61995020-61995042 ACCCAAGCACACAGGCACACGGG + Intergenic
1054646112 9:67593671-67593693 ACCCAAGCACACAGGCACACGGG - Intergenic
1054921522 9:70547713-70547735 AGCCTAGGACACAGGGAAGGTGG + Intronic
1055883905 9:81036319-81036341 ACCCAAAGACAAAGGCAAGCAGG + Intergenic
1060053331 9:120392403-120392425 GACCTAGGACACAGGGGATCTGG + Intronic
1060216677 9:121742657-121742679 AGCCCAGGACTCAGGCAAGCTGG - Intronic
1061234003 9:129331931-129331953 GGCCTGGGACACAGGCATTCTGG - Intergenic
1185503126 X:613916-613938 ACTGGAGGACACAGCCAATCAGG - Intergenic
1189561498 X:42195679-42195701 TCCCTGGAACACAGGCAAACTGG - Intergenic
1190331141 X:49236094-49236116 ACCCCAGGACCCTGGCACTCGGG + Intronic
1191891777 X:65950804-65950826 GAGCTAGGACAAAGGCAATCAGG + Intergenic
1197352659 X:125397514-125397536 ACCCTAGGACAGGTGCAGTCTGG - Intergenic
1200865694 Y:8040910-8040932 AACCTAGCACACAGGTAATGTGG + Intergenic