ID: 1064091729

View in Genome Browser
Species Human (GRCh38)
Location 10:12391125-12391147
Sequence TTTTGGCCATGAAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064091721_1064091729 13 Left 1064091721 10:12391089-12391111 CCCTTTCTCAGGCCATGATACGT 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG No data
1064091724_1064091729 1 Left 1064091724 10:12391101-12391123 CCATGATACGTTGGTATCTCAGT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG No data
1064091722_1064091729 12 Left 1064091722 10:12391090-12391112 CCTTTCTCAGGCCATGATACGTT No data
Right 1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064091729 Original CRISPR TTTTGGCCATGAAGGGTAGA GGG Intronic
No off target data available for this crispr