ID: 1064103739

View in Genome Browser
Species Human (GRCh38)
Location 10:12484338-12484360
Sequence CTCTGTGTTTGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103730_1064103739 23 Left 1064103730 10:12484292-12484314 CCATCTCTCTTCGTGTTTCACCT 0: 1
1: 0
2: 3
3: 28
4: 325
Right 1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG No data
1064103733_1064103739 0 Left 1064103733 10:12484315-12484337 CCAGATACAGGAAAACGCGTGAA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG No data
1064103732_1064103739 3 Left 1064103732 10:12484312-12484334 CCTCCAGATACAGGAAAACGCGT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103739 Original CRISPR CTCTGTGTTTGGAGGGAGGA GGG Intronic
No off target data available for this crispr