ID: 1064103770

View in Genome Browser
Species Human (GRCh38)
Location 10:12484580-12484602
Sequence CTGCCTGGCTTCCACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103770_1064103779 12 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103779 10:12484615-12484637 GGGGAGGGTGAGCTCATTCACGG No data
1064103770_1064103781 14 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG No data
1064103770_1064103776 -7 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103776 10:12484596-12484618 CAGGCAGGGAAATAGCTGCGGGG No data
1064103770_1064103773 -9 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103773 10:12484594-12484616 GCCAGGCAGGGAAATAGCTGCGG No data
1064103770_1064103780 13 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103780 10:12484616-12484638 GGGAGGGTGAGCTCATTCACGGG No data
1064103770_1064103777 -4 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103777 10:12484599-12484621 GCAGGGAAATAGCTGCGGGGAGG No data
1064103770_1064103775 -8 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103775 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG No data
1064103770_1064103778 -3 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103778 10:12484600-12484622 CAGGGAAATAGCTGCGGGGAGGG No data
1064103770_1064103782 29 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103782 10:12484632-12484654 TCACGGGGACCACTCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103770 Original CRISPR CTGCCTGGCTTCCACCATCT TGG (reversed) Intronic