ID: 1064103770

View in Genome Browser
Species Human (GRCh38)
Location 10:12484580-12484602
Sequence CTGCCTGGCTTCCACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 316}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103770_1064103781 14 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG No data
1064103770_1064103779 12 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103779 10:12484615-12484637 GGGGAGGGTGAGCTCATTCACGG No data
1064103770_1064103776 -7 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103776 10:12484596-12484618 CAGGCAGGGAAATAGCTGCGGGG No data
1064103770_1064103775 -8 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103775 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG No data
1064103770_1064103777 -4 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103777 10:12484599-12484621 GCAGGGAAATAGCTGCGGGGAGG No data
1064103770_1064103778 -3 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103778 10:12484600-12484622 CAGGGAAATAGCTGCGGGGAGGG No data
1064103770_1064103782 29 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103782 10:12484632-12484654 TCACGGGGACCACTCAGCAGTGG No data
1064103770_1064103773 -9 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103773 10:12484594-12484616 GCCAGGCAGGGAAATAGCTGCGG No data
1064103770_1064103780 13 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103780 10:12484616-12484638 GGGAGGGTGAGCTCATTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103770 Original CRISPR CTGCCTGGCTTCCACCATCT TGG (reversed) Intronic
900190878 1:1351724-1351746 CTGCCTGGCTTCTGACCTCTGGG - Intergenic
900646221 1:3709929-3709951 CTGGCTGGCTTCCCCCATCTAGG + Intronic
902202529 1:14844711-14844733 CTTCTTGGCTTCCACCAGGTTGG + Intronic
903578037 1:24351314-24351336 CTGCCTGCCTTCCTCCTCCTTGG + Intronic
905905552 1:41615769-41615791 CTGCATCGCTTCCACAATGTGGG - Intronic
906186590 1:43866741-43866763 TAGCCTGTCTTCCAGCATCTAGG - Intronic
906355809 1:45105700-45105722 CTGCCTGGCTGCCCCCGTCGGGG + Intronic
907438252 1:54463067-54463089 CTAGCTCCCTTCCACCATCTGGG + Intergenic
909433651 1:75616394-75616416 CTGCCTGGCTTTCTCCTTCCCGG - Intergenic
909623060 1:77687375-77687397 CTGCCCGGCCTGCACCGTCTGGG + Intergenic
911872715 1:103119486-103119508 CTTCCTGGGTTCCACCGTGTTGG - Intergenic
912325075 1:108750039-108750061 ATGGCTGGTTTCCACCATCTAGG + Intronic
912733981 1:112133797-112133819 CAGCCTGGCTTCCACCTTCCTGG - Intergenic
913078516 1:115360717-115360739 CTTCCTGGCTGCCCCCATCTGGG - Intergenic
913221851 1:116666799-116666821 CTGCCTGGCATCAACCGTTTGGG + Exonic
913318892 1:117575208-117575230 CTTCCAGGCTTCCACCAGCAAGG + Intergenic
915298623 1:154939364-154939386 CTGCCTGCCTTCCACAACCCAGG + Intergenic
915331145 1:155113084-155113106 GTGCCAGGGTTTCACCATCTTGG - Intergenic
915755302 1:158253920-158253942 CTGCCTGGAGTCAAGCATCTTGG - Intergenic
916624562 1:166541200-166541222 TTACCTGCCTTCCATCATCTTGG + Intergenic
919745726 1:201008201-201008223 CTCCCTGGCTGCCACAGTCTGGG + Intronic
920121593 1:203662822-203662844 CCACCTGCCTTCCACTATCTGGG - Intronic
922459255 1:225802271-225802293 CTGACTGGGTTTCACCATGTAGG - Intergenic
1064103770 10:12484580-12484602 CTGCCTGGCTTCCACCATCTTGG - Intronic
1064289774 10:14023034-14023056 CTGCCTGGCTGCCACTGCCTGGG - Intronic
1064360987 10:14664066-14664088 CTTCCTGGATTCCTCCAGCTGGG + Intronic
1064588629 10:16865416-16865438 CTGTCTGCCTTCCTCCACCTGGG - Intronic
1065204360 10:23343674-23343696 CTGCCCGGATTCCAGAATCTTGG - Intronic
1066379999 10:34893081-34893103 CAGACTGGGTTTCACCATCTTGG + Intergenic
1066645948 10:37609290-37609312 CTCAATGGCTTCCACCATTTTGG - Intergenic
1067055818 10:43049286-43049308 CTGCGTGGCTTGCACCCGCTGGG + Intergenic
1067086500 10:43243173-43243195 CTGCCTGGCCGCCCCCGTCTGGG + Intronic
1067283432 10:44890377-44890399 CTCCCTGGCTACCACCCTATCGG - Intergenic
1067799492 10:49349307-49349329 CTGCCTGCCTTCCTCCCTCCCGG - Intergenic
1069821306 10:71230354-71230376 CTGCCTGTCTTCAACCTGCTTGG - Intronic
1070790135 10:79184216-79184238 CTGTCTTCCTTCCACCATCAGGG + Intronic
1070812712 10:79306340-79306362 CTGCCTGGCATCACCCACCTTGG - Exonic
1070866465 10:79710418-79710440 CTGCCTGCCTGCCACCACCCAGG + Exonic
1071633375 10:87232639-87232661 CTGCCTGCCTGCCACCACCCAGG + Exonic
1071646824 10:87364857-87364879 CTGCCTGCCTGCCACCACCCAGG + Exonic
1073034350 10:100552910-100552932 CTGCTTGTCTTCAGCCATCTTGG + Exonic
1073082065 10:100866636-100866658 CTTCCTGGCTTTCAGCGTCTTGG - Intergenic
1073149111 10:101299634-101299656 CTCCCCGACCTCCACCATCTGGG + Intergenic
1074201034 10:111235377-111235399 CTGCCTGGCTTTCAAAATTTGGG + Intergenic
1075304039 10:121351792-121351814 CTTCCTTGCAGCCACCATCTTGG - Intergenic
1075622663 10:123939316-123939338 CTGCCTGCCTTCCACCTGCTGGG - Intronic
1076761014 10:132605625-132605647 CTGCCTGGCTGACCCCAGCTTGG - Intronic
1076817171 10:132920695-132920717 CTGGCTGGTGTCCACCCTCTCGG + Intronic
1076834450 10:133014114-133014136 CTGCGTGGCTGCAGCCATCTGGG - Intergenic
1077120680 11:906571-906593 CTGTCTGTGTTCCAGCATCTGGG - Intronic
1078105368 11:8355005-8355027 CTGCCTGGCCTCCAGCTTCCGGG + Intergenic
1078830196 11:14971147-14971169 CTTCCTGGCTCTCAGCATCTTGG - Exonic
1079005795 11:16790332-16790354 CTGGGTGGCTGCCACCACCTTGG - Intronic
1079157087 11:17958194-17958216 CTGCCTGGCCTCCTCCTTCCGGG - Intronic
1082104942 11:48211439-48211461 CTGCCCGGCTTTCACTTTCTGGG + Intergenic
1084009989 11:66342327-66342349 TTCCCTGGCTTTCCCCATCTGGG - Intronic
1088223485 11:107592483-107592505 CTACCTGCTTTCCACCATATTGG - Intronic
1089116924 11:116102886-116102908 CTACCTGGCCTGCACAATCTTGG + Intergenic
1089300387 11:117495225-117495247 CTGCCTGCCTACCGCCAGCTGGG - Intronic
1089418656 11:118314677-118314699 CTGCATGGCTTCCACAACCATGG + Intronic
1089554600 11:119309486-119309508 AAGGCTGGCTTCCACCATCCAGG - Exonic
1090226219 11:125073728-125073750 CTCCCTGACATCCACCACCTGGG + Intronic
1091746501 12:2996187-2996209 CTGCCTGGCTTCCAACAGGATGG + Intronic
1092029943 12:5275585-5275607 TGGCCTGGCTCCCACCCTCTAGG - Intergenic
1092257145 12:6933376-6933398 CTGGCTGGGTTTCACCATGTTGG + Intronic
1092857657 12:12689797-12689819 CTACCTGGCTCTCACCTTCTTGG + Intronic
1093143221 12:15534650-15534672 CTGTCTGGCATCCTCCTTCTTGG - Intronic
1094092661 12:26668477-26668499 CTACCTGGCTTCCCTCAACTAGG - Intronic
1094370067 12:29728416-29728438 CTCCCTGGCTTCCCACATGTGGG - Intronic
1094404849 12:30106504-30106526 CTCCCTGGCTTCCCACATGTGGG - Intergenic
1095946410 12:47756297-47756319 CTACCTTGCTTCCACAAGCTGGG + Intronic
1096967028 12:55636916-55636938 CTGCCTGAATTCCTCCTTCTGGG + Exonic
1096992857 12:55819065-55819087 CTGGCTGGCCTACATCATCTTGG + Exonic
1101858360 12:108462928-108462950 CTGCCTTTCTTCCCCCACCTTGG - Intergenic
1102327684 12:112002272-112002294 CAGCCAGGGTTTCACCATCTTGG - Intronic
1103235952 12:119372562-119372584 CTGCCTGACTTCCATAATGTGGG - Intronic
1105835901 13:24211827-24211849 CTGCCTGTCGTCCTCCAGCTGGG + Intronic
1106696129 13:32175390-32175412 CTCACTGCCTTCCACCCTCTGGG + Intronic
1108039022 13:46322177-46322199 CAGACTGGCTTTCACCATGTTGG + Intergenic
1108217632 13:48200808-48200830 TTGCCTGTCTTCTACCATCTTGG - Intergenic
1108454720 13:50601706-50601728 TTGACTGTCTTCCACCATTTTGG - Intronic
1108591186 13:51914355-51914377 TTGCCTGGCTTTCTCCACCTTGG - Intergenic
1109880999 13:68476164-68476186 ATGCCTGGCTTGCCCCATTTGGG - Intergenic
1114173801 14:20300682-20300704 GTTCCAGGCTTCCACCAGCTCGG + Exonic
1114308574 14:21445381-21445403 CGGCCAGGGTTTCACCATCTTGG - Intronic
1116491376 14:45507372-45507394 CTACCTGTCTTCCTCCATCATGG - Intergenic
1118812875 14:69288259-69288281 CCTCCTGGCTTCCAGCATCCCGG + Intronic
1120753995 14:88224794-88224816 CTGACAGGGTTTCACCATCTTGG + Intronic
1120759300 14:88271665-88271687 CTGCCTGTCTTCCACCAGAGAGG - Intronic
1121425781 14:93850909-93850931 CTGCCTGGCTCCGAGCATCCTGG - Intergenic
1121694186 14:95899503-95899525 CTGCCTGTCTTCATCCATTTGGG + Intergenic
1121798441 14:96754479-96754501 CAGCCAGGCCTCCTCCATCTGGG - Intergenic
1126460004 15:48904855-48904877 CAGCCTGGGTTACAGCATCTGGG + Intronic
1126704509 15:51395032-51395054 CTGCCTGGCTTCCAACACCAGGG + Intronic
1126775334 15:52095276-52095298 CTGCCTGACTGCCGCCATCATGG + Intergenic
1126878100 15:53065770-53065792 CTGCCTGACTTCCTCGAGCTGGG - Intergenic
1128292302 15:66487300-66487322 CTGCCTGGTTTCCTTCACCTTGG + Intronic
1128452485 15:67813757-67813779 CTGCCTGCCTCCAGCCATCTAGG + Intergenic
1129179334 15:73862395-73862417 CTGCCTGGGGTCCACCTCCTGGG - Intergenic
1129737810 15:77975682-77975704 GGGCCTGGCTTCCAGGATCTGGG + Intergenic
1132163455 15:99564437-99564459 CTGGCTGGCTTCCTCCCTCAAGG - Intergenic
1133261981 16:4556803-4556825 CTGGCTGGCTTCCAGCAGCTGGG - Exonic
1133914904 16:10100815-10100837 CTGGCTGAGTGCCACCATCTGGG - Intronic
1136188908 16:28603983-28604005 ATCCCTGCCTGCCACCATCTGGG + Intergenic
1137393482 16:48100694-48100716 CAGCCTCTCTTCCAGCATCTTGG - Intronic
1138307247 16:55989124-55989146 CTGCCTGGCCGCCCCCATCTGGG + Intergenic
1139788240 16:69411492-69411514 ATGCCTGGGTTTCACCATGTTGG - Intergenic
1139967992 16:70756172-70756194 CTGCCTGGCTTCCTGCCTCAGGG - Intronic
1141157171 16:81605368-81605390 CTGCCTGGACCCCACAATCTAGG - Intronic
1141620413 16:85234318-85234340 CTCTCTGGGCTCCACCATCTTGG + Intergenic
1141913168 16:87074891-87074913 CTGACTGCCTCCCACCATCAGGG + Intergenic
1142402064 16:89864245-89864267 CAGCCTGACCTCCTCCATCTGGG - Intronic
1142488330 17:261047-261069 CTGCCTGGCTCCCGCCATCATGG - Intronic
1143298037 17:5885856-5885878 CTGCCCGGCTTCCAAGCTCTTGG + Intronic
1143597916 17:7926414-7926436 TTGTCTGGCTTCAACTATCTGGG + Intronic
1143964321 17:10745905-10745927 GAGACTGGGTTCCACCATCTTGG - Intergenic
1144418026 17:15070056-15070078 CTGCTTGTCTTGCACCATCCAGG - Intergenic
1144441776 17:15289511-15289533 CTGCTTGCCTTCCACACTCTGGG - Intergenic
1144686794 17:17231417-17231439 CTGCCTGTCTGCCTCCCTCTCGG - Intronic
1144686892 17:17232026-17232048 CTGCCTGTCTGCCTCCCTCTCGG - Intronic
1145304814 17:21667979-21668001 CAGCATGGCTGCCACCATCCTGG - Intergenic
1145753095 17:27369117-27369139 CTGCCTGGCTCTCACAATGTAGG - Intergenic
1146913094 17:36660541-36660563 CTGCCTTTCTGCCTCCATCTTGG + Intergenic
1146977897 17:37131352-37131374 CTGCCCGGCTTCCATCTGCTGGG - Intronic
1148746232 17:49919942-49919964 CTGCTTGGCTTCCATCATGGGGG + Intergenic
1150483732 17:65530290-65530312 GTGCCTGGCCTTCATCATCTCGG - Intronic
1150597198 17:66616649-66616671 CTAAGTGGTTTCCACCATCTTGG - Intronic
1151179615 17:72317475-72317497 GAGCATGGCTTCCACCCTCTGGG - Intergenic
1151943777 17:77308200-77308222 CTGCCTGTCTGCCACCATGATGG - Intronic
1152561567 17:81081405-81081427 CTGCCAGGCTGGCAGCATCTTGG + Intronic
1152609759 17:81309818-81309840 CTGCCTGGGGTGCACCTTCTCGG - Intergenic
1152613869 17:81329114-81329136 CTGCCTGGGTTACCCCAGCTGGG + Intronic
1153716894 18:7859385-7859407 CTACCTGGCTGCCACCAGCAAGG - Intronic
1154986663 18:21558231-21558253 CTGCTTGGCTGACACCATTTGGG - Intronic
1155364387 18:25035830-25035852 CTGCCTGGCCTTCACACTCTGGG - Intergenic
1155428055 18:25726553-25726575 CTGGCCGGCTGCCACCACCTGGG - Intergenic
1155847779 18:30731178-30731200 CTGCCTCCCTTCCACCACCTAGG - Intergenic
1155970033 18:32074386-32074408 CTGCCTGGCTTGTACCTTCATGG - Intergenic
1157425641 18:47582197-47582219 CTGCCTGGCTCCCAGCCCCTGGG - Intergenic
1158658102 18:59359227-59359249 TTGCCTGGATCCCGCCATCTTGG + Exonic
1160081816 18:75735137-75735159 CAGACCAGCTTCCACCATCTTGG + Intergenic
1162257401 19:9501964-9501986 GAGCCTGGCTTTCACCATGTTGG - Intergenic
1162509556 19:11109885-11109907 CTGACTGGGTTTCACCATGTTGG + Intronic
1162580518 19:11527133-11527155 CAGACGGGCTTTCACCATCTCGG - Intronic
1162781021 19:13007083-13007105 CCGCCTGGCTTCCATCTTCCCGG + Intronic
1163371514 19:16903761-16903783 CTCCCTGGCCTCCACCAACCTGG - Exonic
1164260096 19:23561814-23561836 CTGCCTGGGTTCTGCCATCAAGG - Intronic
1164629089 19:29749448-29749470 CTCCCTCGCTTCCACCAGCTGGG + Intergenic
1165906948 19:39200052-39200074 CTGCCTGGGTCCCCCCATCCTGG + Intronic
1166064975 19:40352371-40352393 CTGCCTGCCCCCCACCGTCTGGG - Intronic
1167208597 19:48119039-48119061 GCTCTTGGCTTCCACCATCTTGG - Intronic
1167729644 19:51244422-51244444 CTGTCAGGCTTTCACCATGTTGG + Intergenic
1168075587 19:53979411-53979433 CTGCCTCGCTTCATCTATCTGGG - Intronic
1168707697 19:58479307-58479329 CTGCCTGAGTCCCATCATCTGGG - Intronic
927435012 2:23059280-23059302 CTGCCAGGGTTCCACCATCAAGG + Intergenic
927737341 2:25535294-25535316 CTGCCTGGCCACCCCCGTCTGGG - Intronic
927737464 2:25535755-25535777 CTGCCTGGCCACCCCCGTCTGGG - Intronic
931680948 2:64750050-64750072 TTGCCAGACTTCCACCATCGGGG - Intronic
931863979 2:66390244-66390266 CTTCCTGGCCTCTGCCATCTGGG - Intergenic
935584236 2:104786060-104786082 CTGCCTGCATTCCTCCAGCTGGG + Intergenic
936888516 2:117341479-117341501 CTCCCAGGCCTTCACCATCTAGG + Intergenic
937086778 2:119177187-119177209 CAGCATGGCTACCACCAGCTGGG + Intergenic
937890107 2:126931967-126931989 CTGCCTGGCTAGGATCATCTGGG - Intergenic
938067986 2:128292224-128292246 CTGCCTGGCATGGACCCTCTGGG - Intronic
938297925 2:130190006-130190028 CTTCCTGCCTGTCACCATCTAGG + Intronic
938458839 2:131484662-131484684 CTTCCTGCCTGTCACCATCTGGG - Intronic
940081780 2:149811407-149811429 CTGACAGGGTTTCACCATCTTGG - Intergenic
940292914 2:152095151-152095173 ATTTCTGGCTTCCACCATTTAGG - Intronic
940882213 2:158958146-158958168 CTGCCCGGCCCCCACCGTCTGGG + Intergenic
940913578 2:159230018-159230040 CTGGCTGGTTTTCACGATCTGGG - Exonic
942841049 2:180360842-180360864 CTGCCTCCAATCCACCATCTTGG + Intergenic
943621944 2:190158655-190158677 CTCCCTGGCTATCATCATCTTGG + Intronic
943782096 2:191836273-191836295 CTGCATGGCTTTCTCCCTCTCGG + Exonic
944304147 2:198159179-198159201 CTTCCTGGCTTGCTCTATCTAGG - Intronic
945194504 2:207225675-207225697 CTGCCTGCCTTCCAAGAGCTGGG - Intergenic
945289579 2:208113717-208113739 CATCCTGGCCTCTACCATCTGGG + Intergenic
945909861 2:215636003-215636025 CTGCCTGTCGTCCACTATCTTGG + Intergenic
946089537 2:217208377-217208399 CATCTTGGCTTCCACCCTCTGGG - Intergenic
947337650 2:229103763-229103785 GAGACTGGCTTTCACCATCTTGG + Intronic
1172015089 20:31868834-31868856 CTGCCTGCCTGCCACCAGCCTGG + Intronic
1173175854 20:40764185-40764207 CTGCCTTTCTTCCCCCATTTAGG + Intergenic
1173202358 20:40963200-40963222 CTGCTTGTGTTCCACCCTCTGGG - Intergenic
1173231920 20:41205145-41205167 CTGCTTGCCTTCTACCATCTAGG + Intronic
1173533787 20:43792628-43792650 CTGCCTGGCTACCAGCATTCTGG - Intergenic
1173556457 20:43969609-43969631 CTGCCAGGGTTCCACCACATCGG - Intronic
1173976161 20:47188215-47188237 CTTCCTGGTGTCCAACATCTGGG - Exonic
1174316910 20:49710604-49710626 CTGACAGGGTTTCACCATCTTGG + Intronic
1174464155 20:50704189-50704211 CAGCCGGGCTTCCACCTTCCAGG - Intergenic
1174628523 20:51935953-51935975 CAGACTGGCTTCCAACTTCTGGG - Intergenic
1175159289 20:56995895-56995917 CTGTCTGGCCTCCAGGATCTGGG + Intergenic
1175179412 20:57134913-57134935 TTGCCTGGCTCACACCATCCAGG - Intergenic
1175387821 20:58608550-58608572 CTGCCTGGTTTCCTTCAGCTGGG - Intergenic
1176010764 20:62893779-62893801 CTGTCTGGCTTCCACCATGTGGG + Exonic
1176345163 21:5737223-5737245 CAGACTGGGTTCCACCATGTTGG + Intergenic
1176351977 21:5857807-5857829 CAGACTGGGTTCCACCATGTTGG + Intergenic
1176499664 21:7587232-7587254 CAGACTGGGTTCCACCATGTTGG - Intergenic
1176539484 21:8135293-8135315 CAGACTGGGTTCCACCATGTTGG + Intergenic
1176558435 21:8318338-8318360 CAGACTGGGTTCCACCATGTTGG + Intergenic
1176861238 21:14012613-14012635 CAGCCTGGCCTCCACCCTCACGG + Intergenic
1178505325 21:33157965-33157987 CTGCCTGGATTCCAGGAACTGGG + Intergenic
1179008028 21:37531638-37531660 CTGCCTGCCTCCCTCCAGCTGGG + Intergenic
1179960443 21:44764609-44764631 CTACCAGGCGGCCACCATCTCGG - Intergenic
1180017692 21:45098006-45098028 CTGCCAGGTTTCCAGCAGCTGGG - Intronic
1181160778 22:20958239-20958261 CTTCTTGGCTCCCACCCTCTAGG - Intergenic
1181527294 22:23497301-23497323 CTGACTGTTTTCCACCCTCTGGG - Intergenic
1181617633 22:24065552-24065574 CTGCCTGGCCGCCATCGTCTGGG - Intronic
1184017041 22:41794153-41794175 CTGCCTGCCTTCCACAATCATGG + Intronic
1184105761 22:42366758-42366780 CTGCCTGGCCTCCCCCATCCTGG - Intergenic
1184342250 22:43892301-43892323 CTTCCTGGCTGTCACCATCCTGG - Intergenic
1203244435 22_KI270733v1_random:51648-51670 CAGACTGGGTTCCACCATGTTGG + Intergenic
950293551 3:11807771-11807793 CTGAGTGGCTTCCACACTCTTGG - Intronic
950865543 3:16185728-16185750 CTGTCTGTCTATCACCATCTTGG - Intronic
951429149 3:22586066-22586088 ATGCCTTGCCTCCACCATCTGGG + Intergenic
952497148 3:33925745-33925767 CTGGCTGCCTTCCACAATCCCGG + Intergenic
954027609 3:47795532-47795554 CGGCCTGGGTTTCACCATATTGG - Intergenic
954762869 3:52889685-52889707 CTGCCTGGCCCCCATCCTCTTGG - Intronic
955416309 3:58695340-58695362 TTACCTGCCTTCCACCATCATGG + Intergenic
956779911 3:72595726-72595748 GTCCCTGGCTTCCCCCACCTAGG + Intergenic
957057584 3:75455839-75455861 CTGCCTGAGTTGCTCCATCTGGG - Intergenic
960581156 3:119279901-119279923 CTGCCAGGCTTCTTCCCTCTGGG + Intergenic
961369886 3:126422770-126422792 CTGCCCTGCCTCCCCCATCTAGG - Intronic
962876467 3:139539363-139539385 CTGCCTGCCTGCCTCCATCCCGG - Intronic
962947176 3:140182698-140182720 CTATCTGGAATCCACCATCTGGG + Intronic
962948772 3:140198942-140198964 CTGCCTGGCTCTCAGCATCTAGG + Intronic
964741798 3:159974403-159974425 CTGACTGGCTTGCACCAATTAGG + Intergenic
965380374 3:167980924-167980946 CCGTCTGCCTTCCACAATCTGGG + Intergenic
965501687 3:169464015-169464037 CTGCCTGGTTTCCACTCTGTGGG - Intronic
966920082 3:184605345-184605367 CTGCCTGGCTCCCACCCACTAGG - Intronic
966939827 3:184738838-184738860 CAGCCTGGCTTCAAGCCTCTCGG + Intergenic
967985935 3:195095398-195095420 TTCCTTGCCTTCCACCATCTGGG + Intronic
968033125 3:195520727-195520749 CAGGCTGGCTTCCAACTTCTGGG + Intronic
968054204 3:195678712-195678734 ATGCCTGGCTTCCAGCAGCTCGG + Intergenic
968101686 3:195970430-195970452 ATGCCTGGCTTCCAGCAGCTCGG - Intergenic
968471026 4:782327-782349 CTGCCTGGGTGCCACCAGCGTGG - Intergenic
968996012 4:3946345-3946367 CTGCTTGTCTTCCACCGACTGGG + Intergenic
969194350 4:5548375-5548397 ATGCATGGCTTCCACCCTCAAGG - Intronic
970533632 4:17007028-17007050 CTTCCTGGCTTCCACTGTCAAGG - Intergenic
970545302 4:17123596-17123618 CTCCCAGGCTGGCACCATCTCGG + Intergenic
970569534 4:17366248-17366270 CTGCCTGGACTCCACCTTCCAGG + Intergenic
970758484 4:19454723-19454745 CTGCTTGGTGGCCACCATCTTGG + Intergenic
972122621 4:35724496-35724518 CTGCCTAGTTTCCAACCTCTTGG - Intergenic
972700796 4:41491721-41491743 CTGCCTGGCCGCCCCCATCTGGG - Intronic
976281827 4:83333992-83334014 CTGCCTGGTTTCCCTCCTCTTGG + Intronic
978138334 4:105289854-105289876 ATGCCTAGCTTACACCTTCTTGG + Intergenic
980022231 4:127723350-127723372 CTGCCTCTCTTTGACCATCTGGG + Exonic
980094745 4:128477794-128477816 ATGGCTGGCATCCACCAGCTGGG - Intergenic
980933983 4:139208868-139208890 CAGCTTTGCTTCCACCTTCTGGG + Intergenic
981156911 4:141448424-141448446 CTGGCTCCATTCCACCATCTAGG - Intergenic
981339898 4:143609529-143609551 CTGCCTGGTTAACACCTTCTTGG + Intronic
981406833 4:144380966-144380988 CTTCCCGGCATCCAACATCTTGG + Intergenic
983449149 4:167889230-167889252 CAGCCAGGCTTTCACCATCTTGG - Intergenic
984263798 4:177472277-177472299 CTGACTGGCCTTCACAATCTAGG + Intergenic
985500507 5:241365-241387 ATGCCTGGCTTCCAGCAGCTCGG + Intronic
985531419 5:436026-436048 CTGCCTGGCTTCCTCTTGCTTGG - Exonic
985534262 5:454481-454503 CTCCCTGGCTTCCAGCATCCCGG + Intronic
985736884 5:1588332-1588354 ATGCCTGGCTTCCAGCAGCTTGG - Intergenic
986233171 5:5885417-5885439 CTCCCAGGTTTCCACCATCTGGG + Intergenic
988882358 5:35517072-35517094 ATCCCTAGCTTCCTCCATCTGGG - Intergenic
990005251 5:50938063-50938085 CTGCCTCCTATCCACCATCTTGG - Intergenic
990709410 5:58564361-58564383 CTGCCTGGCCGCCCCCATCTGGG - Intergenic
990936791 5:61160016-61160038 CTCCCTGGCCTCAATCATCTTGG + Exonic
991638448 5:68730251-68730273 CTGCCTGGCAACCAGCAACTAGG - Intergenic
992433664 5:76734289-76734311 CTGCCTGGAGTCCTCCATCGGGG - Exonic
992540242 5:77757422-77757444 TTACCTGCCTTCCACCATCATGG + Intronic
996183775 5:120451658-120451680 GTTCCTGGCTCCCACCAGCTGGG + Intergenic
997585361 5:135040238-135040260 CTCCCTGGCTGCCACGCTCTGGG - Intronic
997622205 5:135306250-135306272 CTGCCTGGCATGCACCACCTTGG + Intronic
999700334 5:154221791-154221813 CTGCCTAGCTTCCTGCTTCTTGG + Intronic
1002625548 5:180525787-180525809 CTGCTTGGCTTCCAGGATATCGG - Intronic
1003792483 6:9562440-9562462 CTTGATGGCTTCCACCATGTTGG - Intergenic
1004465709 6:15883006-15883028 AGGCCTGGTTTCCACCGTCTGGG + Intergenic
1006607166 6:35266392-35266414 CTGCCTGGCTCCCACATTTTTGG + Intronic
1006809473 6:36810630-36810652 ATGCCAGGCCTGCACCATCTTGG + Intronic
1007464102 6:42039829-42039851 CTCCCTCCCTTCCACCTTCTTGG + Intronic
1007854602 6:44842065-44842087 CTGCATGGCTTCCTCCATTCAGG - Intronic
1009217861 6:60944938-60944960 CTGCCTGGCTGCGACCCTGTTGG + Intergenic
1009497916 6:64373948-64373970 CTGCCTGGCTATCAGCAGCTGGG + Intronic
1012206813 6:96471820-96471842 CTGCCTGGCTTATGTCATCTTGG - Intergenic
1016834500 6:148463796-148463818 CTGCCCAGCTTTCCCCATCTGGG + Intronic
1017215265 6:151899944-151899966 CTGCCTGGCCGCCATCGTCTGGG - Intronic
1018638190 6:165883464-165883486 CTCACTGCCTCCCACCATCTGGG - Intronic
1018731227 6:166652672-166652694 CTGCTTGGGTTCCCCCAGCTAGG + Intronic
1019378697 7:710456-710478 CTTCCTGGCCTCCTGCATCTGGG - Intronic
1019478129 7:1253943-1253965 CTGCCTAGCACCCACCATCCCGG + Intergenic
1019609223 7:1928512-1928534 CTGCCTGGGTCCTGCCATCTAGG - Intronic
1019609344 7:1929096-1929118 CTGCCTGGAATCCACCTGCTCGG - Intronic
1021125090 7:16842733-16842755 CTGCCTGGTCTCCAACACCTTGG + Intergenic
1021508611 7:21411442-21411464 CTGCCTGCCTTCCTACTTCTAGG - Intergenic
1022542744 7:31153577-31153599 CTGCCTGGCTGCCCCCGTCTGGG + Intergenic
1022952076 7:35348745-35348767 TTGCTTGGCTTCCAGCAACTGGG + Intergenic
1023954293 7:44872038-44872060 CTGCCTGGCCACCCCCATCTGGG - Intergenic
1025282811 7:57640596-57640618 CAGCATGGCTGCCACCATCCTGG - Intergenic
1025301902 7:57824824-57824846 CAGCATGGCTGCCACCATCCTGG + Intergenic
1026301922 7:69105522-69105544 CTGCCTGCTTTACACCATGTAGG - Intergenic
1027046514 7:74994771-74994793 CACCCTGGCTTCAACCACCTTGG - Intronic
1029261324 7:99304686-99304708 CTGCTCGGCCTCCTCCATCTTGG - Intergenic
1029371589 7:100154246-100154268 ATGTCTGTCTTCCACCTTCTGGG + Intronic
1029386469 7:100246831-100246853 CACCCTGGCTTCAACCACCTTGG + Intronic
1029610310 7:101623057-101623079 CTGCCAGGCTTTCACCATCATGG - Exonic
1030051122 7:105538500-105538522 CTGCATGACTTCCTCCAACTGGG - Intronic
1032112055 7:129084457-129084479 CAGACGGGCTTTCACCATCTTGG - Intergenic
1032421291 7:131782085-131782107 CTGCCTGTCTTCCATGCTCTTGG + Intergenic
1032683623 7:134209667-134209689 CTCCCAGGCTTCCACCAACCCGG + Intronic
1032790810 7:135241186-135241208 CTGACTGATTTCCAGCATCTTGG - Intronic
1035754672 8:2022523-2022545 CTGCCTTGATTCCACCCTCCTGG - Intergenic
1037021476 8:13976938-13976960 CCACCTGGCCTCCACCAACTTGG - Intergenic
1037186005 8:16064536-16064558 CCTCCTGACTTCCACCACCTGGG - Intergenic
1038498645 8:28025057-28025079 CTGCCTGCCTTCCACCCACTGGG + Intronic
1041088744 8:54282186-54282208 CTGCCTGGCTTCCCCATTCCAGG + Intergenic
1042121828 8:65496762-65496784 CTTCTTGGCTTTCACTATCTTGG + Intergenic
1042535630 8:69855744-69855766 CTGCCCGGCCGCCCCCATCTGGG + Intergenic
1043378546 8:79677924-79677946 ATACATGGCTTCCACCAGCTGGG - Intergenic
1044461970 8:92456120-92456142 AGGCCTGGTGTCCACCATCTTGG + Intergenic
1046221966 8:111228213-111228235 TTGCCTGCCTTCCATCATCATGG - Intergenic
1049141324 8:140957163-140957185 GTGCCTCGCTTCTATCATCTTGG + Intronic
1051991687 9:23160553-23160575 CTGCCTGGCTGGCATCAGCTGGG + Intergenic
1052956110 9:34254343-34254365 CTGCAGGGCCCCCACCATCTCGG + Exonic
1053267499 9:36725947-36725969 CTTCCTGGCTTCAACCTTCAGGG + Intergenic
1055931121 9:81560640-81560662 CTCCCTGGCCTCCACCCTCTGGG - Intergenic
1055990804 9:82103024-82103046 CTTCCTAGCTTCCTCCCTCTTGG + Intergenic
1057239590 9:93396997-93397019 CACCTTGGCTTCCACCAGCTGGG + Intergenic
1057353983 9:94320535-94320557 CTGCCTGCCTGCCACCACCCAGG - Exonic
1057653782 9:96937100-96937122 CTGCCTGCCTGCCACCACCCAGG + Exonic
1057838300 9:98464464-98464486 CTGCCTGGCCGCCCCCATCTGGG + Intronic
1058264063 9:102875247-102875269 ATGCCTGGCTTCCAGCTACTAGG + Intergenic
1058615405 9:106821955-106821977 CTGAGAGGCTTCCACCCTCTTGG - Intergenic
1058684067 9:107465584-107465606 CTGCCTGGCTTCCAGCTCCCGGG - Intergenic
1058790125 9:108436180-108436202 CTGCCTGGCAACCATCAGCTGGG + Intergenic
1059407306 9:114109147-114109169 GAGCCTGGCCTCCACCCTCTGGG - Intergenic
1060044498 9:120328907-120328929 CTGCCTGCCTTCTGCCACCTGGG - Intergenic
1060296804 9:122348534-122348556 CTTCCTGGCTTCCTCCTTCCTGG + Intergenic
1061989563 9:134151511-134151533 ATGCCTGGCTTGTACCTTCTGGG + Intronic
1062107908 9:134765753-134765775 CTGCTTGTCTGCCCCCATCTCGG + Intronic
1062509302 9:136896063-136896085 CTGCCTGCAGTCCACCTTCTAGG + Intronic
1203460768 Un_GL000220v1:34733-34755 CAGACTGGGTTCCACCATGTTGG + Intergenic
1186202812 X:7171193-7171215 CTGGCTGGCTTCCAGAATCCTGG + Intergenic
1186792241 X:13010618-13010640 ATGCCTGTCCTCCACAATCTTGG - Intergenic
1186838952 X:13465756-13465778 CAGGCTGGCTTTCACCATGTTGG + Intergenic
1190053586 X:47169686-47169708 CTCCCTGGCTTCCACATGCTTGG + Intronic
1190181749 X:48198144-48198166 CAGGCTGGCTTCGACCACCTGGG + Intronic
1191141635 X:57121239-57121261 CTGCCTGGCGTCCACCGCCGGGG + Exonic
1191143276 X:57137206-57137228 CTGCCTGGCGTCCACCGCCGGGG + Intronic
1191210008 X:57875068-57875090 CTGCCTCCAGTCCACCATCTTGG - Intergenic
1191843556 X:65529878-65529900 CTGCCTGCCTTCCCCCCTCTAGG - Exonic
1191847130 X:65555308-65555330 CTGACTGGCTGCCACCGTGTTGG - Intergenic
1192369733 X:70503486-70503508 CTTCCTGGGTTCCACCAACAGGG + Exonic
1193406268 X:81106081-81106103 CTGCCTGGCTACCACCATCAGGG + Intergenic
1194248097 X:91539037-91539059 CTGCCTTGCTTCCACCACTGTGG + Intergenic
1195177624 X:102326380-102326402 CTACCTGGCCTCCATCTTCTTGG - Intronic
1195181240 X:102360713-102360735 CTACCTGGCCTCCATCTTCTTGG + Intronic
1195462084 X:105138873-105138895 CTCACAGGCTTCCACCATATAGG - Intronic
1195706196 X:107739578-107739600 CTTCCTGGCTTCCCTCATGTGGG - Intronic
1196056422 X:111361000-111361022 CTCCCTGGCTTCTACCCACTAGG + Intronic
1200567111 Y:4780566-4780588 CTGCCTTGCTTCCACCACTGTGG + Intergenic
1201368521 Y:13235086-13235108 ATGCCAGCCTTCCACCTTCTTGG - Intergenic
1201487011 Y:14505572-14505594 CTGCCTGGCTCCCACTTTGTTGG + Intergenic