ID: 1064103773

View in Genome Browser
Species Human (GRCh38)
Location 10:12484594-12484616
Sequence GCCAGGCAGGGAAATAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103766_1064103773 19 Left 1064103766 10:12484552-12484574 CCACTGGCAGCTGAGCTTACTTG No data
Right 1064103773 10:12484594-12484616 GCCAGGCAGGGAAATAGCTGCGG No data
1064103770_1064103773 -9 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103773 10:12484594-12484616 GCCAGGCAGGGAAATAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103773 Original CRISPR GCCAGGCAGGGAAATAGCTG CGG Intronic