ID: 1064103774

View in Genome Browser
Species Human (GRCh38)
Location 10:12484595-12484617
Sequence CCCGCAGCTATTTCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103774_1064103779 -3 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1064103779 10:12484615-12484637 GGGGAGGGTGAGCTCATTCACGG No data
1064103774_1064103781 -1 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG No data
1064103774_1064103780 -2 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1064103780 10:12484616-12484638 GGGAGGGTGAGCTCATTCACGGG No data
1064103774_1064103782 14 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1064103782 10:12484632-12484654 TCACGGGGACCACTCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103774 Original CRISPR CCCGCAGCTATTTCCCTGCC TGG (reversed) Intronic
900524055 1:3119917-3119939 CCCACAGCCCCTTCCCTGCCTGG + Intronic
902334793 1:15748609-15748631 CCTTCAGCTGTTTCCCAGCCTGG - Intergenic
903545291 1:24120209-24120231 CCTGCAGCTCATTCCCAGCCAGG - Exonic
905036714 1:34923471-34923493 CCAGCAGCTGCTTCCTTGCCAGG - Intronic
905322295 1:37126669-37126691 CCCTGGGATATTTCCCTGCCCGG + Intergenic
905602831 1:39268947-39268969 CCCCCAGATATTTTGCTGCCTGG + Intronic
906754242 1:48293445-48293467 CCCACAGCTATTTCCATTCCTGG + Intergenic
910935916 1:92484607-92484629 CGGGCAGCTAGTTCCCTCCCGGG - Intronic
914827531 1:151146401-151146423 CCCGCAGCCCCTTCCCTGCCCGG + Intronic
914878588 1:151530485-151530507 CCAGCTGCTGTTTCTCTGCCTGG - Exonic
918150257 1:181792146-181792168 CTCGCAGCATTTTGCCTGCCTGG + Intronic
922572464 1:226642176-226642198 CCAGCAGCTCCTTTCCTGCCTGG + Intronic
922709248 1:227814788-227814810 CCCAAAACAATTTCCCTGCCAGG - Intergenic
924052692 1:240093283-240093305 CCCGCGGCCGCTTCCCTGCCCGG + Exonic
1063476672 10:6334909-6334931 CCAGCACCTATTCCACTGCCTGG - Intergenic
1064103774 10:12484595-12484617 CCCGCAGCTATTTCCCTGCCTGG - Intronic
1065693056 10:28354913-28354935 CCTACAGCACTTTCCCTGCCAGG + Intergenic
1066107025 10:32165283-32165305 CCCTTGGCCATTTCCCTGCCAGG + Intergenic
1066298298 10:34075348-34075370 TCTGCAGCTGCTTCCCTGCCTGG - Intergenic
1067726091 10:48772188-48772210 CCTTCAGCTCTTTCCCTGCCCGG - Intronic
1075931361 10:126299511-126299533 CCTGGATCTATTTCCTTGCCAGG + Intronic
1076190816 10:128482188-128482210 CCCGCAGCAGTCTCCCTGCTAGG - Intergenic
1077553728 11:3215900-3215922 CCTGCAGCTATTTCCTGGGCTGG + Intergenic
1077997470 11:7466384-7466406 CCAGCATCTATTACCATGCCTGG + Intronic
1079131225 11:17747954-17747976 CCATGAGCCATTTCCCTGCCAGG + Intronic
1081641903 11:44761666-44761688 CCCGCAGCTCCTTCCCGGCATGG + Intronic
1081693993 11:45096918-45096940 CACGCAGCTGCCTCCCTGCCAGG - Intronic
1083486709 11:62987640-62987662 CCTGCAGCTCTTTCCCCGCCTGG + Intergenic
1084620042 11:70263519-70263541 CCCCCAGCTGGTCCCCTGCCTGG - Intergenic
1085385503 11:76155597-76155619 CCTGCAGTTATCTCACTGCCAGG - Intergenic
1089557069 11:119320681-119320703 CCCTCAGCCCCTTCCCTGCCAGG + Intronic
1090861162 11:130653838-130653860 CCTGCAGCTTTTTTCCTCCCGGG + Intergenic
1092719602 12:11428489-11428511 CTCTCAGCTCTGTCCCTGCCTGG + Intronic
1092747689 12:11689120-11689142 CCCGCCCCATTTTCCCTGCCAGG - Intronic
1095296376 12:40531768-40531790 CCCTGACCTATTTCCCTTCCAGG - Intronic
1095998608 12:48110747-48110769 ACAGCAGCTGCTTCCCTGCCAGG - Intronic
1096493744 12:52027209-52027231 GCCTCAGCTATTTCCAGGCCTGG - Intronic
1096529739 12:52235031-52235053 CCCCTGGCTGTTTCCCTGCCTGG - Intronic
1100216920 12:92460260-92460282 CCAGCGGCTAGTTCCATGCCTGG + Intergenic
1102624101 12:114220639-114220661 CTCGCAGCTCTGTCCCTGCCAGG - Intergenic
1104487881 12:129167483-129167505 CCTGCAGCTTTTTCCCAGGCAGG - Intronic
1104644230 12:130485717-130485739 CCCGGAGCTGTTTCGGTGCCTGG - Intronic
1104978073 12:132560958-132560980 CCCTCAGCTCTTTCCCTTCTAGG - Intronic
1105209638 13:18250186-18250208 CCTGCAGCTCTTTCCCACCCTGG + Intergenic
1109199617 13:59415691-59415713 CACTGAGCTATTTCACTGCCAGG - Intergenic
1110226304 13:73123057-73123079 CCTGCATCTCATTCCCTGCCTGG - Intergenic
1114610424 14:24036533-24036555 ACCGCACCGACTTCCCTGCCCGG - Intergenic
1114737003 14:25051808-25051830 ACCTCAGCCATTTCCCTACCAGG + Intergenic
1116498030 14:45586606-45586628 CCAGCGGCTATTTCTCTGGCTGG + Intergenic
1121211387 14:92210354-92210376 CCCCCAGCTTTCTCCCTGCAGGG - Intergenic
1123036506 14:105474062-105474084 CCCGCCGCCCCTTCCCTGCCTGG + Intronic
1125188363 15:36959433-36959455 CCAGAAGCTAGTTCACTGCCTGG + Intronic
1125391358 15:39196194-39196216 CCCATAGCTATTTCCCTGGAAGG + Intergenic
1126780157 15:52132858-52132880 CCCCCAGCTCTTTGCTTGCCTGG + Intronic
1127747620 15:61996071-61996093 TCTCCAGCTCTTTCCCTGCCAGG - Intronic
1129781954 15:78278155-78278177 CAGGCAGGTATTTACCTGCCGGG + Intronic
1130678915 15:85979446-85979468 CCCCCAGCTCACTCCCTGCCTGG + Intergenic
1131075043 15:89490226-89490248 CCCTCATCTGTTTCCCTTCCAGG + Intronic
1131164776 15:90134457-90134479 TCCTCAGGTCTTTCCCTGCCAGG + Intergenic
1132887896 16:2190445-2190467 CCAGCAGCTTTGTGCCTGCCGGG - Intronic
1140457243 16:75112567-75112589 CCCTCAGCTCTTCCCCTCCCTGG + Intronic
1140474645 16:75233772-75233794 CCCCCAGCTCTTGCCCTGCAGGG - Intronic
1143770566 17:9165981-9166003 CCCTCAGCTCTTTCCTTTCCTGG + Intronic
1145813946 17:27782074-27782096 CCCGCAGCTGTTCCACTGCCCGG - Exonic
1146483746 17:33226761-33226783 CCAGGGGCTCTTTCCCTGCCTGG + Intronic
1149387643 17:56157578-56157600 CCAGGGACTATTTCCCTGCCTGG + Intronic
1149584668 17:57777822-57777844 CCCTCAACTGTTACCCTGCCTGG + Intergenic
1150224047 17:63513360-63513382 CCCTCTGCCTTTTCCCTGCCAGG + Intronic
1151756455 17:76077943-76077965 CCAGCAGCTGTTTCACTCCCCGG + Intronic
1152297911 17:79479095-79479117 CCTGCAGGCTTTTCCCTGCCCGG + Intronic
1152830759 17:82495837-82495859 TCCCCAGCTCTTTCTCTGCCTGG - Intergenic
1152986231 18:323902-323924 CACTCAGTTATTTCTCTGCCTGG - Intronic
1153976324 18:10271399-10271421 CCCGCAGCCTCTTCTCTGCCTGG - Intergenic
1155150119 18:23116489-23116511 CCGGCACCTCTCTCCCTGCCAGG - Intergenic
1160057270 18:75495168-75495190 CTCGCAGCTTCTTTCCTGCCTGG - Intergenic
1161478321 19:4498410-4498432 CCCGCTGCCACCTCCCTGCCAGG + Intronic
1163504804 19:17699267-17699289 CCCTCATCTCTCTCCCTGCCTGG - Intergenic
1163731716 19:18953523-18953545 CCAGCAGCTATATCCCTCCTGGG - Intergenic
1166088967 19:40495754-40495776 CCCTCAGCTATTTCAATGTCAGG - Intronic
1168009806 19:53521180-53521202 CCGGGAGCTATTTGCCTCCCAGG + Exonic
1168076707 19:53984325-53984347 CCAGCACCGATTGCCCTGCCTGG - Exonic
927203445 2:20592443-20592465 CCGACAGCTCTGTCCCTGCCCGG + Intronic
927782960 2:25954238-25954260 CCCGCAGCTCTTTTCATCCCGGG - Intronic
928094913 2:28398547-28398569 TCCCCAGCTGCTTCCCTGCCAGG - Intronic
928171182 2:29003795-29003817 CCCCCAGCCCTTTCCCTGCCTGG - Intronic
928433386 2:31238645-31238667 CCCTTTGCTATTTCTCTGCCCGG + Intronic
929133519 2:38602204-38602226 CCCGCAGCGAGTCCACTGCCGGG - Intronic
929720392 2:44361951-44361973 GCCGCAGCTCGTCCCCTGCCAGG - Exonic
930614561 2:53579795-53579817 CCAGCACCTAGTACCCTGCCTGG - Intronic
931684477 2:64781696-64781718 CCCTCAGCTATTACCAAGCCAGG + Intergenic
937921274 2:127133325-127133347 CCCTCAGCTAGTTCCCTCCCCGG - Intergenic
945849686 2:214990984-214991006 CCTGCAGCCATTTCTTTGCCTGG - Exonic
948763900 2:240209741-240209763 CCCTCAGCTCTGTCCCGGCCAGG + Intergenic
1169249146 20:4046787-4046809 CCCCCAGCACTTTCTCTGCCAGG - Intergenic
1171290797 20:23981853-23981875 CCTGCAGCTCTTTCCCACCCTGG + Intergenic
1175392667 20:58636904-58636926 CCAGCAGCCAGATCCCTGCCTGG + Intergenic
1179239932 21:39581112-39581134 CCCACAGCTATGGTCCTGCCAGG - Intronic
1180766628 22:18349213-18349235 CCTGCAGCTCTTTCCCACCCTGG - Intergenic
1180779686 22:18513165-18513187 CCTGCAGCTCTTTCCCACCCTGG + Intergenic
1180812401 22:18770486-18770508 CCTGCAGCTCTTTCCCACCCTGG + Intergenic
1181198561 22:21204733-21204755 CCTGCAGCTCTTTCCCACCCTGG + Intergenic
1181401176 22:22651067-22651089 CCTGCAGCTCTTTCCCACCCTGG - Intergenic
1181703143 22:24632147-24632169 CCTGCAGCTCTTTCCCACCCTGG - Intergenic
1182549584 22:31093603-31093625 CCCGCAGCTCTTCAGCTGCCCGG - Intronic
1184212415 22:43043772-43043794 CCCCCAGCTCTTTCCAGGCCTGG + Intronic
1184274725 22:43403906-43403928 CCCACTGCTTTTCCCCTGCCTGG - Intergenic
1184938379 22:47741452-47741474 CCCGCTGCTAATTCTCGGCCGGG - Intergenic
1203228244 22_KI270731v1_random:90104-90126 CCTGCAGCTCTTTCCCACCCTGG - Intergenic
952972214 3:38658722-38658744 CCTGCTGCCATTCCCCTGCCTGG + Intergenic
953213542 3:40897365-40897387 GCCACAGCCATTTCCCTGGCTGG + Intergenic
954580382 3:51700028-51700050 CCAGCTGCTTTCTCCCTGCCAGG + Intronic
956008827 3:64808647-64808669 CCCGCAGCTTCTTGCTTGCCTGG - Intergenic
961755947 3:129127533-129127555 CCCCCAGCTGTTTCCAGGCCTGG + Intronic
962515842 3:136151100-136151122 ACTGTAGCTATTTCCCTACCAGG + Exonic
963263573 3:143216835-143216857 CCCAAAGCCATTTTCCTGCCAGG + Intergenic
964434021 3:156633533-156633555 CCTGCAGCTCCTTCACTGCCAGG + Intergenic
970608853 4:17707385-17707407 CCCCCAGATATTTCCCCACCAGG - Intronic
985149066 4:186927864-186927886 CCCCCAGATAGTTTCCTGCCAGG + Intergenic
986018448 5:3778864-3778886 TGGGGAGCTATTTCCCTGCCAGG + Intergenic
989102870 5:37837420-37837442 CCTGCTGCTTTTGCCCTGCCGGG - Intronic
990381143 5:55222915-55222937 CCCGCTGTTATTTAACTGCCAGG + Intronic
992484107 5:77179463-77179485 CTTGCAGCTATTACCATGCCTGG - Intergenic
997641268 5:135450375-135450397 CCAGCAGCTGGTTCCCTGCTTGG - Intronic
997653069 5:135536233-135536255 CCCGCCTCTGTTTCACTGCCTGG - Intergenic
1000350504 5:160349127-160349149 CCAGAAGCTTGTTCCCTGCCTGG + Exonic
1003129230 6:3381186-3381208 CCCGTGGCTATCTCTCTGCCAGG + Intronic
1003506874 6:6746840-6746862 CCCCAAGCCATTTCCCTCCCCGG - Intergenic
1003920222 6:10825825-10825847 CCCAAAGCTATTTTCCTGTCAGG + Intronic
1004862554 6:19819792-19819814 CCTGCAGCACATTCCCTGCCTGG - Intergenic
1004909188 6:20266965-20266987 TCCTCAGCTAATTTCCTGCCAGG - Intergenic
1005964972 6:30720859-30720881 TCCGCATCTCTCTCCCTGCCCGG - Intronic
1017553346 6:155535550-155535572 CACTCAGCCATTTCCCTGCAAGG + Intergenic
1018904118 6:168065194-168065216 CCCACAGCTGTGTCCCTGCAGGG + Intronic
1023908106 7:44536364-44536386 CCCTCAACAATTACCCTGCCGGG - Exonic
1032878164 7:136059976-136059998 CCCCCAGCTCTTTGCATGCCTGG - Intergenic
1033229431 7:139584755-139584777 CCTGCAGCTTTTCCACTGCCTGG + Intronic
1036600405 8:10255497-10255519 CCAGCAGCTCCTTACCTGCCGGG - Intronic
1037741463 8:21612408-21612430 CCCCCAGCCACTTCTCTGCCTGG + Intergenic
1049782175 8:144434115-144434137 CCCCCAGCCGGTTCCCTGCCAGG + Exonic
1049803992 8:144530686-144530708 CCTGCAGGTACTTCCCTCCCCGG - Exonic
1053739555 9:41124945-41124967 CCCGCAGGGGTTGCCCTGCCCGG - Intergenic
1054688796 9:68306375-68306397 CCCGCAGGGGTTGCCCTGCCCGG + Intergenic
1055921247 9:81463291-81463313 CCACCAGCTATTTCCCTGCCAGG + Intergenic
1056401118 9:86228355-86228377 CCCACAGCTATTTCTCTCCGTGG - Intronic
1057016988 9:91660734-91660756 CCCAAAGCTGTTTCTCTGCCTGG + Intronic
1058842197 9:108920625-108920647 CCCTCAGCCTGTTCCCTGCCTGG - Intronic
1058919596 9:109600286-109600308 CCTGCAGCTCCTTCCCTGCCAGG + Intergenic
1061376290 9:130226622-130226644 CTCCCAGCTATGTCCCTGCTAGG - Intronic
1185992558 X:4908160-4908182 CCCACAGCTATTTCTCAGCAAGG - Intergenic
1187813154 X:23202796-23202818 CCCACAGCTATTTTCCATCCAGG + Intergenic
1191211695 X:57891735-57891757 CTCTCAGCTAGTTCCCAGCCAGG - Intergenic
1199261128 X:145776628-145776650 CCGGCAGGTGTTTACCTGCCAGG + Intergenic