ID: 1064103775

View in Genome Browser
Species Human (GRCh38)
Location 10:12484595-12484617
Sequence CCAGGCAGGGAAATAGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103766_1064103775 20 Left 1064103766 10:12484552-12484574 CCACTGGCAGCTGAGCTTACTTG No data
Right 1064103775 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG No data
1064103770_1064103775 -8 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103775 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103775 Original CRISPR CCAGGCAGGGAAATAGCTGC GGG Intronic