ID: 1064103776 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:12484596-12484618 |
Sequence | CAGGCAGGGAAATAGCTGCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1064103770_1064103776 | -7 | Left | 1064103770 | 10:12484580-12484602 | CCAAGATGGTGGAAGCCAGGCAG | No data | ||
Right | 1064103776 | 10:12484596-12484618 | CAGGCAGGGAAATAGCTGCGGGG | No data | ||||
1064103766_1064103776 | 21 | Left | 1064103766 | 10:12484552-12484574 | CCACTGGCAGCTGAGCTTACTTG | No data | ||
Right | 1064103776 | 10:12484596-12484618 | CAGGCAGGGAAATAGCTGCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1064103776 | Original CRISPR | CAGGCAGGGAAATAGCTGCG GGG | Intronic | ||