ID: 1064103779

View in Genome Browser
Species Human (GRCh38)
Location 10:12484615-12484637
Sequence GGGGAGGGTGAGCTCATTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103770_1064103779 12 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103779 10:12484615-12484637 GGGGAGGGTGAGCTCATTCACGG No data
1064103774_1064103779 -3 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG No data
Right 1064103779 10:12484615-12484637 GGGGAGGGTGAGCTCATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103779 Original CRISPR GGGGAGGGTGAGCTCATTCA CGG Intronic