ID: 1064103781

View in Genome Browser
Species Human (GRCh38)
Location 10:12484617-12484639
Sequence GGAGGGTGAGCTCATTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103770_1064103781 14 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG No data
1064103774_1064103781 -1 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103781 Original CRISPR GGAGGGTGAGCTCATTCACG GGG Intronic
No off target data available for this crispr