ID: 1064103782

View in Genome Browser
Species Human (GRCh38)
Location 10:12484632-12484654
Sequence TCACGGGGACCACTCAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064103774_1064103782 14 Left 1064103774 10:12484595-12484617 CCAGGCAGGGAAATAGCTGCGGG No data
Right 1064103782 10:12484632-12484654 TCACGGGGACCACTCAGCAGTGG No data
1064103770_1064103782 29 Left 1064103770 10:12484580-12484602 CCAAGATGGTGGAAGCCAGGCAG No data
Right 1064103782 10:12484632-12484654 TCACGGGGACCACTCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064103782 Original CRISPR TCACGGGGACCACTCAGCAG TGG Intronic