ID: 1064106120

View in Genome Browser
Species Human (GRCh38)
Location 10:12502327-12502349
Sequence TGATGTACCGTGCAAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064106114_1064106120 5 Left 1064106114 10:12502299-12502321 CCCAGCCAGGGAATGGAAAATCA 0: 1
1: 0
2: 2
3: 20
4: 199
Right 1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG No data
1064106110_1064106120 20 Left 1064106110 10:12502284-12502306 CCAACGGAAGGAGAACCCAGCCA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG No data
1064106117_1064106120 0 Left 1064106117 10:12502304-12502326 CCAGGGAATGGAAAATCAGGCGG No data
Right 1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG No data
1064106115_1064106120 4 Left 1064106115 10:12502300-12502322 CCAGCCAGGGAATGGAAAATCAG 0: 1
1: 0
2: 0
3: 22
4: 217
Right 1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG No data
1064106109_1064106120 25 Left 1064106109 10:12502279-12502301 CCAGTCCAACGGAAGGAGAACCC 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1064106120 10:12502327-12502349 TGATGTACCGTGCAAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064106120 Original CRISPR TGATGTACCGTGCAAGCTGG AGG Intronic
No off target data available for this crispr