ID: 1064110039

View in Genome Browser
Species Human (GRCh38)
Location 10:12530642-12530664
Sequence CGCTGCCTCCCCAGACCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064110039 Original CRISPR CGCTGCCTCCCCAGACCCCG AGG (reversed) Intronic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
900608127 1:3532846-3532868 CACTGCATCCCCAGAACCCAGGG - Intronic
901238644 1:7680532-7680554 TGCTGGGGCCCCAGACCCCGCGG - Intronic
901322164 1:8346392-8346414 CCCTGGCTCCCCAGACCCTAAGG + Intergenic
901378193 1:8854743-8854765 CCCTGCCTGCCCAGCCCCCAAGG - Intergenic
901703263 1:11056604-11056626 CACTGACTCCTCAGACCCCATGG - Exonic
902601213 1:17540858-17540880 CCCTCTCTCCCCAGAACCCGAGG - Intronic
902633335 1:17718914-17718936 CCCTGCCTTCCCAGAACCCAGGG - Intergenic
902943078 1:19814491-19814513 TGCTGTCTCCCCAGCACCCGGGG - Exonic
903810189 1:26031025-26031047 AGCTGCATCACCAGACCCCTGGG - Intronic
903938644 1:26913686-26913708 AGCTGCCTCCCCAGGACCAGCGG - Exonic
904063152 1:27726470-27726492 CGCTGCCTCCCCCGCCGCCGCGG + Intronic
904330110 1:29753340-29753362 GGCTCCATCCCCAGACCCTGAGG - Intergenic
904536339 1:31201993-31202015 CCCTGGCTCCCCAGGCCCAGCGG - Intronic
906285513 1:44585139-44585161 TCCTGACTCCCCAGGCCCCGTGG + Intronic
911053628 1:93693044-93693066 AGCTGCCTCTCCAGTGCCCGGGG + Intronic
917978921 1:180257427-180257449 GGCTGTGTCCCCAGCCCCCGAGG + Intronic
918265476 1:182838564-182838586 CGCCTCCGCCCCCGACCCCGGGG + Intergenic
919989159 1:202697139-202697161 TGCTGCCTTTCCAGACCCTGTGG - Intronic
924505327 1:244677842-244677864 CACTGCCTCCTCAAACCCCTGGG - Intronic
1062774755 10:135644-135666 CGCCGCCGCCCCAGAGGCCGCGG - Intronic
1062939562 10:1411165-1411187 AGATGCCTCCCCAGCCTCCGTGG + Intronic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1069739709 10:70679615-70679637 CTCTGCCTCCCCAGGCCCTGGGG + Intronic
1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG + Intronic
1075645474 10:124093358-124093380 CGCTGCCTGGCCCGAACCCGCGG + Intronic
1075684829 10:124356501-124356523 GGCTGCCTCCCCAGAATCCGTGG + Intergenic
1075747300 10:124736687-124736709 TGCTGCCTGCCCCCACCCCGTGG - Intronic
1076334013 10:129692868-129692890 AGCTGCAGCCCCAGACCTCGCGG + Intronic
1076555151 10:131316603-131316625 TGCTGCCTACACAGACCCAGTGG + Intergenic
1077027569 11:448095-448117 CGCGGCCCCGCCAGACCGCGCGG - Intergenic
1077085379 11:747452-747474 CGCCGCCGCCGCAGACCCCTCGG + Exonic
1077136212 11:1000470-1000492 GGCTGCCCCCCCTGCCCCCGCGG + Exonic
1077281615 11:1748617-1748639 CGCGGGCTCTCCAGACCCCGGGG + Intronic
1077439628 11:2561925-2561947 GGCTGCTTCCCCAGGCCCCATGG - Intronic
1077976285 11:7251930-7251952 CCGTCCCTCCCCAGACACCGAGG - Exonic
1078138350 11:8671492-8671514 GGCTGCCTCCCCAGACGGAGAGG - Intronic
1079423764 11:20319698-20319720 AGCTGCCTCCCCAAATCCCCAGG - Intergenic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1083895617 11:65618397-65618419 GCCTGCCTCACCAGACGCCGGGG + Exonic
1084455271 11:69264639-69264661 CGCTCCCTCCCCAGGGCCCAGGG - Intergenic
1085229022 11:74948952-74948974 CGTCGCCTCCGCAGACCCCTCGG - Exonic
1085311631 11:75520416-75520438 CACTGCCTCCCCTGGCCCGGAGG + Intronic
1085527679 11:77173662-77173684 CCTTCCCTCCCCAGATCCCGAGG - Intronic
1088256498 11:107908395-107908417 CGCCGCCGCCGCAGACGCCGCGG + Intronic
1089452612 11:118608305-118608327 GGCGGCCTCCCCGGCCCCCGAGG - Intronic
1090351792 11:126112654-126112676 GGCTGCCGCGCCAGACCCCAGGG + Intergenic
1091402404 12:188993-189015 CTCTGCTGCCCCAGACCCCCTGG - Intergenic
1100437421 12:94584362-94584384 CGCAGCCTCCCCAGAACCAGAGG + Intronic
1101446144 12:104738150-104738172 TGCAGCCTTCCCAGACCCCGCGG + Intronic
1101600482 12:106205421-106205443 CTCAGCCTCCTCAGACCCCAGGG - Intergenic
1101605790 12:106247256-106247278 CGCTGCCTGCCCAGGCCCGGAGG - Intronic
1102298992 12:111757710-111757732 ACCTGCCTCCCCAGACCCCTGGG - Intronic
1103642554 12:122363645-122363667 CGCCCCCTCCCCAGACGCCCAGG + Intronic
1103901108 12:124303970-124303992 CCCTGCCTTGCCAGCCCCCGTGG + Intronic
1103921728 12:124402763-124402785 CTCCGCCTCCCCAGGCCCCTAGG - Intronic
1104614676 12:130257719-130257741 AGCTGCACCCCCAAACCCCGTGG - Intergenic
1104962936 12:132496822-132496844 CGCTTCCTTCCCAGGCCCTGCGG + Intronic
1104962963 12:132496927-132496949 CGCTTCCTTCCCAGGCCCTGCGG + Intronic
1105020783 12:132815366-132815388 CGCTGCTGCCCCAGACACCTGGG + Intronic
1105916428 13:24921264-24921286 TGCTGCCTCCCCAGAACCTTAGG + Intronic
1106645472 13:31629575-31629597 CACTGCCACCCCAGGCCGCGAGG + Intergenic
1106810034 13:33350242-33350264 CGGCGCCTCCCCCGCCCCCGTGG + Intronic
1107516250 13:41132459-41132481 CGCCGCCTAGCCAGTCCCCGTGG - Exonic
1107522180 13:41194205-41194227 CGCCGCCTCGCCAGTCCCCGTGG - Exonic
1113328654 13:109308144-109308166 CCCTGCCTCACAAGACCCCATGG - Intergenic
1113424978 13:110200359-110200381 CCTTGCCTCCCTGGACCCCGGGG - Intronic
1114460769 14:22884869-22884891 GGCTGCCTCCCCTGAGCCCAAGG - Exonic
1115596103 14:34910287-34910309 CTCTGCCTCCCCAGTTCCAGTGG - Intergenic
1117028990 14:51651018-51651040 CGCCCCCTCCCCAGACCCCGAGG + Intronic
1117135498 14:52730700-52730722 CTCGTCCTCTCCAGACCCCGCGG + Intronic
1118771512 14:68945764-68945786 CCCTGCCTGCCCAGACACCTGGG + Intronic
1119411156 14:74431351-74431373 CCCTGCCTCCCCAGACCCACAGG - Intergenic
1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG + Intronic
1123487594 15:20755665-20755687 GGCTGCCTGCCCAGACCTGGCGG - Intergenic
1123544086 15:21324723-21324745 GGCTGCCTGCCCAGACCTGGCGG - Intergenic
1128830295 15:70762914-70762936 TGTTGGCTCCCCAGTCCCCGGGG - Intronic
1130253884 15:82316940-82316962 ACCTTCCTCCCCAGACCACGTGG - Intergenic
1130390186 15:83447849-83447871 CTCCGCCTCCCGAGTCCCCGCGG - Intronic
1202952428 15_KI270727v1_random:51996-52018 GGCTGCCTGCCCAGACCTGGCGG - Intergenic
1132611353 16:817832-817854 CGCAGCCTCCCCAGCAGCCGAGG + Intergenic
1132669456 16:1096674-1096696 CGCAGCCTCCCCAGGCTCCGTGG + Intergenic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1136620285 16:31423952-31423974 CGCTGCCCCCACACACCTCGCGG - Exonic
1138563954 16:57818995-57819017 TACTGTCTCCCCAGACTCCGTGG - Intronic
1141783929 16:86185624-86185646 CGCAGCCACCCCAGAGCCCTCGG + Intergenic
1141849916 16:86638048-86638070 AGCAGCCTCCCCTGACCCCCAGG - Intergenic
1142067666 16:88072095-88072117 CGTGGCCTCCTCGGACCCCGCGG + Exonic
1142286030 16:89171902-89171924 CGCTGCCTCCCTCGACGCTGCGG + Intronic
1142693562 17:1621233-1621255 AGGAGCCTCCCCACACCCCGGGG + Intronic
1143411736 17:6713411-6713433 CGCCCCCTCCCCAATCCCCGGGG - Exonic
1146052996 17:29567434-29567456 CGCCGGCTCCCGGGACCCCGTGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147437425 17:40425809-40425831 CTCTGCCTCCCCATACACCAGGG - Intergenic
1147440552 17:40444511-40444533 CCCTGGCTCCCCAGACCACTGGG - Intronic
1147586206 17:41655207-41655229 CGGTGCCCACCCAGACCCTGGGG + Intergenic
1148615790 17:48998534-48998556 TGCTGCTTCCCGAGACGCCGAGG + Intronic
1151235828 17:72719298-72719320 CCCTGCCTCCCGAGGCCCCGTGG + Intronic
1152140460 17:78533443-78533465 CGCTGCCTCCTCCCACCACGGGG - Intronic
1152386870 17:79980003-79980025 CGGTGCCTCCCCAGACCCTCTGG + Intronic
1152814080 17:82397380-82397402 CGCTGCCTCACCCGTCCCCAGGG - Intronic
1157040483 18:44033300-44033322 TGGTGCCTCTCCAGACCCCAAGG - Intergenic
1158722293 18:59936286-59936308 CACTTCCTCCCCAGACCCAGAGG + Intergenic
1160454859 18:78993016-78993038 CGCCGCCTGCCCTGGCCCCGGGG + Exonic
1160673192 19:375975-375997 CGGTCCCTTCCCAGCCCCCGCGG + Exonic
1160696969 19:489484-489506 CGTTCCCTCCCCGGACCCCCCGG + Intronic
1160796745 19:949193-949215 CACTGCCTCCCCACACCCCTGGG - Intronic
1160807511 19:998995-999017 CGGTGTCTCCCCAGATCCCGCGG - Intergenic
1160928695 19:1559598-1559620 CTCTGCTTCCCCAGAGCCTGAGG - Intronic
1161590075 19:5125557-5125579 CGCTCCCTCCCGAGATCCCCGGG + Intronic
1161782571 19:6303019-6303041 TGCCTCCTCCCCTGACCCCGTGG - Intergenic
1162572419 19:11480886-11480908 CGCAACCTCCCCGGGCCCCGCGG - Exonic
1162821783 19:13227453-13227475 CACTTCTTCCCCAGACCCAGGGG + Exonic
1162917908 19:13884026-13884048 CACTGCCTCCCCAGCACCCAGGG + Intronic
1163520269 19:17787904-17787926 CAATCCCTCCCCACACCCCGGGG - Intronic
1165284795 19:34832760-34832782 CTCTGCCTCCGGTGACCCCGAGG + Intergenic
1165356555 19:35307982-35308004 CCCGGCCTCCCCAGACCCTTGGG - Intronic
1165696893 19:37907409-37907431 CGGTGGCTGCCCGGACCCCGAGG + Intronic
1165851130 19:38851006-38851028 CCCTGCCATCCCAGACCCCCAGG + Intronic
1165988773 19:39793463-39793485 CTCTGCCTCCCCAGGCCCCTGGG - Intergenic
1166076103 19:40414689-40414711 CCCTGACTCACCAGACCCCGGGG + Intergenic
1166111684 19:40626839-40626861 CGCTGGCTCCAGAAACCCCGGGG + Intronic
1166857793 19:45791997-45792019 GCCTGCCACCCCAGAACCCGGGG + Intronic
1167158132 19:47751506-47751528 CGCTGTATCCACAGACCCCCTGG + Exonic
1167592417 19:50411301-50411323 GGCTGCCTCCCCAGCCTCCTTGG + Intronic
1167678728 19:50906515-50906537 CCCTCCTTCCCCAGACCCAGAGG - Exonic
1168277198 19:55284665-55284687 GGCTGGCTGCCCAGACCCCTGGG + Intronic
1168305283 19:55431944-55431966 TGCTCCCTCCCCAGACTCCAGGG - Exonic
925042214 2:740602-740624 CGCTGCCTCTCCAGCCCTCCTGG - Intergenic
925635167 2:5935586-5935608 CACTGCATCCCCAGACCCCAGGG - Intergenic
925731805 2:6924429-6924451 CGCTTCCTCACCAGACTCCCAGG - Intronic
927125945 2:20012538-20012560 CTCCGCCGCCCCCGACCCCGTGG - Exonic
927506007 2:23615354-23615376 TGCTGCCTCCCCAGCCACCCTGG + Intronic
927552268 2:24010497-24010519 CCCTGCCTGCCCAGAGCTCGGGG - Intronic
929597691 2:43186681-43186703 GGCAGCCTCCCAGGACCCCGGGG + Intergenic
931052314 2:58428515-58428537 CGCTGCCTCCCCGCCCCCGGCGG + Intergenic
932435905 2:71702461-71702483 AGCTGCCTCCCCAGCCACAGGGG + Intergenic
932583453 2:73007620-73007642 CGCTGCCTCCCCACATACCCGGG + Intronic
933698596 2:85238276-85238298 CGCTGCCTGCCCTGACTTCGGGG - Intronic
934035735 2:88087340-88087362 CTCTGTTTCCCCAGACCCCACGG + Intronic
935622937 2:105144393-105144415 CACCCCCTCCCCCGACCCCGCGG - Intergenic
937380000 2:121367792-121367814 CGCTGCCTCCCCTGCCACTGAGG - Exonic
937637488 2:124172486-124172508 CACTGCCACCTCTGACCCCGGGG + Intronic
938168655 2:129056014-129056036 CACTGCCTCCTCACACCCCTGGG + Intergenic
938386272 2:130869490-130869512 AGCTGCCTTCCCAGACTCAGGGG - Intronic
942457780 2:176149787-176149809 CGCTGCTGCTGCAGACCCCGAGG - Intergenic
944564668 2:200977263-200977285 CACTGCCTCCCCAAACCCATGGG + Exonic
1171429451 20:25071945-25071967 CACAGGCTCCCCAGACCCCGTGG - Intronic
1172227804 20:33316902-33316924 CGCTGCTGCCCCAGGCCCAGGGG + Intergenic
1173665013 20:44757145-44757167 TGCGTCCTCCCCAGACCCCATGG - Intronic
1174386443 20:50190706-50190728 CGCGGCCGCCCGAGACCCCCGGG - Intergenic
1175892814 20:62322921-62322943 AGCTGCCTCCCCTGGGCCCGAGG + Intronic
1176132247 20:63501014-63501036 CGGTGGCTCCCAGGACCCCGAGG - Intergenic
1176254974 20:64146985-64147007 CGCTGCCACCCCACACCTAGTGG - Intergenic
1176309071 21:5140251-5140273 CGCTGCCTCACCCCACCCCCAGG - Intronic
1178890060 21:36513669-36513691 CTCTGCCTCCCCAGCCACAGAGG - Intronic
1179293954 21:40044044-40044066 CGCTGCCTCCTCCGTCCCTGGGG - Intronic
1179654758 21:42838050-42838072 CCGTGCCTCCCTGGACCCCGGGG - Intergenic
1179657351 21:42853498-42853520 AGCTGCCGCCCCACACCCCCAGG + Intronic
1179847990 21:44121782-44121804 CGCTGCCTCACCCCACCCCCAGG + Intronic
1180090345 21:45531013-45531035 CGCTACCTCCCCCTGCCCCGTGG - Intronic
1180717560 22:17882071-17882093 GGCTGTTTCCCCAGACCTCGTGG - Intronic
1180972260 22:19821800-19821822 CTCTGGCTCCCCAGATCCCAGGG + Intronic
1181082764 22:20425492-20425514 CGCCGCCTTCTCAGGCCCCGGGG + Exonic
1182025047 22:27111322-27111344 GGCTGCCTCCCCACACGCAGAGG - Intergenic
1182257766 22:29050545-29050567 CGCTGCCCCCTCCGCCCCCGCGG - Exonic
1182269451 22:29144410-29144432 GACTGCCACCCCAGGCCCCGTGG + Intronic
1182338857 22:29603537-29603559 CGCACCCTCCCCACAGCCCGGGG - Exonic
1182380553 22:29883633-29883655 GGCTGCCTTCCCAGACCTGGCGG + Intronic
1182472064 22:30554838-30554860 TGGTGCCACCTCAGACCCCGGGG - Exonic
1183605838 22:38866385-38866407 CGGTGCCTCCTCCGAGCCCGAGG - Exonic
1184244605 22:43229559-43229581 AGCTGCCTCCCCAGGGCCCTGGG - Intronic
1184444193 22:44537739-44537761 CGCTACCTCCCCACATCCCCTGG - Intergenic
1184773761 22:46613065-46613087 CGCTGCCTCCCCAGCGCCTGTGG + Intronic
1185206372 22:49541418-49541440 CGCTGCCTCCCGAGGGCCCCGGG + Intronic
949893015 3:8747157-8747179 CACTGCCTCCCAAGACCACTGGG - Intronic
953979575 3:47406919-47406941 CCCCACCTCCTCAGACCCCGAGG - Intronic
954148982 3:48647857-48647879 TGCTGCCTTCCCAGTCCCCACGG - Exonic
954394511 3:50286457-50286479 CGCTGCCCCTGCAGACTCCGTGG + Exonic
955916494 3:63912717-63912739 CGCCGCCTCCGCAGCCCCAGCGG + Exonic
955941432 3:64150094-64150116 CACTTCCTCCCCAGACCCTTGGG + Intronic
960055854 3:113275934-113275956 TGCTGCCTCCCCAGAGGCAGGGG + Intronic
960223740 3:115146931-115146953 GGCTGCCTCGCCCGACCCGGCGG - Intronic
960586265 3:119323387-119323409 CCCCGCCGGCCCAGACCCCGCGG + Intronic
960610646 3:119552073-119552095 CTCTGCCTCTCCTGACCCCTTGG + Intronic
961308284 3:125975053-125975075 CGCTGCCTCCTCAAACTCCTGGG + Intronic
961538512 3:127584940-127584962 AGCAGCCTCCTCAGACCACGAGG + Intronic
964474851 3:157089107-157089129 GGCTGCCTCCCCCGACGCTGGGG - Intergenic
967723939 3:192844140-192844162 CGCAGCCTCGCCAGCCCACGGGG + Intronic
967979783 3:195058870-195058892 CGCTGACACGCCAGGCCCCGGGG + Intergenic
968035195 3:195542833-195542855 CGTTACCTACCCAGACCCCAGGG - Intronic
968434144 4:576309-576331 CGCCCCCTCCCCAGCCCGCGGGG + Intergenic
968479492 4:826968-826990 CGCTCCCTCCCCTGGCCCCCGGG + Intergenic
968697571 4:2040663-2040685 CGCTGCCTCCCCAGGCGCCTGGG + Intronic
968915769 4:3496532-3496554 CGCCCCCTCCCCAGATGCCGAGG + Intronic
968926537 4:3551404-3551426 CACTGCCTTCTCAGCCCCCGGGG + Intergenic
968944101 4:3654594-3654616 CGCTGCCTTCCCAGACGCTGCGG - Intergenic
969492684 4:7509197-7509219 CGCTGCCCCCCCAGAGCAAGGGG + Intronic
969676646 4:8618076-8618098 CCCTGCCTTCCCAGCCCCAGCGG - Intronic
972532781 4:39976705-39976727 CCCTGTCTCCCCAGAGGCCGGGG + Intronic
973989254 4:56387555-56387577 CGCTGCCTCTCCTGAAGCCGAGG + Intergenic
974009301 4:56592696-56592718 GGCGGCCGCCCCCGACCCCGCGG - Intronic
975785266 4:77880939-77880961 AGCTGCCTCCACAGAGCCCCAGG - Intronic
976702784 4:87989483-87989505 CGGTGCCTCCTGAGACCCCTCGG + Intergenic
977399189 4:96510131-96510153 CACTGCCACCCCAGACCACAAGG - Intergenic
982466975 4:155743665-155743687 AGCGGCCTCCCCAGCCCCAGTGG - Intergenic
983940099 4:173529003-173529025 CGCGGCCCCCCCAGGCCCGGGGG + Exonic
985849805 5:2380682-2380704 TGCTCCCTCCCCAGAACCCCTGG - Intergenic
990950464 5:61293351-61293373 GGCTGCCTGCCCAGTCCCCTGGG - Intergenic
992478146 5:77123672-77123694 CTCTGCCTCCCCAGGCTCAGGGG - Intergenic
993197198 5:84764437-84764459 CACTGCCACCCCAGGCCACGAGG + Intergenic
993387158 5:87273812-87273834 CTCTGCCTCCCCAGTAGCCGGGG + Intronic
994710433 5:103258858-103258880 CGCTGCCTCCGCCGTGCCCGGGG - Exonic
997240307 5:132301762-132301784 CGGGGCCTACCCAGACCCCAGGG - Intronic
997306403 5:132840128-132840150 CACTGCCTCCCCTGAACCCTGGG - Intergenic
997584092 5:135034442-135034464 CGCCGCCTCCCCGCCCCCCGCGG + Intronic
998665830 5:144296234-144296256 TGCTGGCTCCCCAGACCTCCTGG - Intronic
999314756 5:150576357-150576379 GGCTGCCTCCCCTGGCACCGAGG + Intergenic
999316606 5:150588285-150588307 CGCAGCTTCCCCCGACCCCCGGG - Intergenic
999754440 5:154653813-154653835 TGCTACCTCCCCATACCCTGGGG + Intergenic
1001246727 5:170110466-170110488 CGCTGCCTACTCAAACCCTGGGG + Intergenic
1002067188 5:176657786-176657808 CACTGCCTCCCCAGTCACCAAGG + Exonic
1002523540 5:179803972-179803994 AGCTGCCTCCCCAGCTCCCGAGG - Intronic
1004903931 6:20218979-20219001 GGCTGCCTCCCCATACCTCTTGG - Intergenic
1006171549 6:32096154-32096176 CGCGGCCTCGGCAGCCCCCGGGG + Intronic
1006852604 6:37109810-37109832 AGCTGCCTCCTCAGCCCCCTTGG - Intergenic
1006914466 6:37585468-37585490 TTCAGCCTCCCCAGACCCCCTGG + Intergenic
1007161143 6:39792571-39792593 TGCTGCCTCCCCAAGCCCCGCGG - Intronic
1007444731 6:41895908-41895930 CGCTGCCTCCGGAAACCCCACGG - Intergenic
1016340890 6:143060752-143060774 CGCGGCCGCGCCAGTCCCCGGGG + Intronic
1018726064 6:166614402-166614424 CGCTTCCTACCCAGGCCCCGAGG + Intronic
1019079251 6:169418562-169418584 AGCTGCCTCACCAGACACCATGG + Intergenic
1019522957 7:1468806-1468828 GGATGCCTCCCCAGCCCCCAGGG - Intergenic
1019686952 7:2387282-2387304 TGGTGCCTCCCTAGACCCCGTGG + Intergenic
1019713794 7:2529372-2529394 CCCTGCTTCCCCCGACCCCAGGG + Intergenic
1019817805 7:3213937-3213959 CGCTGCCTCCCAGGAGCCTGGGG + Intergenic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1020094809 7:5362339-5362361 TGCTGCAGCCCCAGGCCCCGTGG + Intronic
1023035810 7:36130613-36130635 AGCAGCCTCCCCAGACCCCCAGG - Intergenic
1024199012 7:47087949-47087971 CTCTGCCTCCCCACCTCCCGTGG + Intergenic
1024586194 7:50844103-50844125 CACAGCCTCCCCAGACACCCTGG - Intergenic
1025604658 7:63030657-63030679 TGCTCCCTCCCCCCACCCCGAGG - Intergenic
1026900126 7:74032428-74032450 AGCTGCTTCCCCAGGCCCCGTGG - Intronic
1026967195 7:74447830-74447852 CGCTGCCTCCACACACTCCTGGG + Intergenic
1028753567 7:94409747-94409769 CCCGGCCTCCCTGGACCCCGCGG + Exonic
1029439070 7:100577422-100577444 CGCCTCCTTCCCTGACCCCGGGG - Intronic
1029456193 7:100673755-100673777 CGCTGCCTCCCCAGAGCGGAGGG - Exonic
1029570053 7:101363214-101363236 CGCTCCCTCCCCCCACCCCCCGG - Intronic
1029729911 7:102432702-102432724 CACTGCAACCCCCGACCCCGGGG - Intergenic
1031899258 7:127392162-127392184 CGCAGCCTCCGCTGACCACGCGG + Exonic
1032119785 7:129147507-129147529 TGCTGCCTCCCCAGATCAGGGGG + Intronic
1032165829 7:129543919-129543941 CGCTGCCTTCCCAGCCTCCCGGG - Intergenic
1033755743 7:144397394-144397416 GGCTGCCTGCCCAGAGCCTGGGG + Exonic
1034470511 7:151252032-151252054 CGCCGCCTCCCCGGCCGCCGCGG - Intronic
1036641721 8:10588867-10588889 CCCTGCCTCCCCACAACCCCGGG - Intergenic
1037562260 8:20085640-20085662 TGCTGCCTCCCCTGCCCCCTTGG - Intergenic
1037776840 8:21841123-21841145 CACTGCCTCCCCAGCACCCTGGG + Intergenic
1037882423 8:22579559-22579581 CGCCCCCACCCCAGTCCCCGAGG - Intronic
1040960491 8:53027145-53027167 CCCTGCCTTTCCAGACCCCTGGG - Intergenic
1041045561 8:53882821-53882843 CCCTTCCTCCCCACACTCCGGGG - Intronic
1041107589 8:54458072-54458094 CGCCGCCTCCCCCGACCCGGGGG - Exonic
1045564468 8:103299103-103299125 CGTTGCCTCCCCAGCACCTGCGG - Intronic
1047382127 8:124373047-124373069 CGCTGCCACCCCAGCCCCGACGG + Intergenic
1047541281 8:125768781-125768803 CGCTCCCTCCCCAAACCCTGTGG - Intergenic
1048886635 8:138914478-138914500 CGCCCCCTCCCCAGGCCCCCTGG - Intergenic
1048960974 8:139576822-139576844 CCCTGCCTCCCCGAACACCGTGG + Intergenic
1049237278 8:141518618-141518640 CGCCGCCTTCCCGGAGCCCGAGG + Exonic
1049310947 8:141933595-141933617 CCCTGGCTCCCCAGAGCCTGGGG + Intergenic
1049443506 8:142619690-142619712 TGCAGCCTCCCCAGCCCCTGGGG + Intergenic
1049597556 8:143491736-143491758 CTCTGCCTCCCCTGCCCCTGAGG - Intronic
1049745964 8:144263444-144263466 CCCTGGCTCCCCAGCCCCCAGGG + Intronic
1050537781 9:6645439-6645461 GGCGGCCGCCCCCGACCCCGCGG + Exonic
1055044454 9:71910601-71910623 TGCGGCGTCCCCAAACCCCGAGG + Intronic
1055770371 9:79710518-79710540 TGCTGCCTCCCCAGTCTCCAGGG + Intronic
1056153956 9:83817250-83817272 CTGAGCCTCCCGAGACCCCGTGG - Intronic
1056555427 9:87683860-87683882 TGCCTCCTCCCCAGACCCCACGG - Intronic
1056738770 9:89234712-89234734 CGCTGCCTCCTCAGCCCGCAGGG - Intergenic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1057759524 9:97861110-97861132 AGCTGCCTTCCCACACCCCTAGG + Intergenic
1059341120 9:113598152-113598174 CTCTGCCTCGCCACACCCTGAGG + Intergenic
1060412205 9:123407195-123407217 CTCTCCCTCCCCAGCCTCCGAGG - Intronic
1060675913 9:125514342-125514364 CGCTGCCTCCCCCAGCCTCGAGG + Intronic
1061348068 9:130042812-130042834 CGCCTCCTCCCCAGGCCGCGAGG + Intronic
1061348091 9:130042879-130042901 CGCCCCCTCCCCAGGCCGCGGGG + Intronic
1061415526 9:130445086-130445108 CTCTGCCTCCGCGGGCCCCGGGG - Intronic
1061483114 9:130906898-130906920 TGCTGCTTCCCAAGGCCCCGGGG + Intronic
1061510565 9:131058538-131058560 TGCTGCCTCCCCAGAGCAGGTGG + Intronic
1061543578 9:131290947-131290969 CCCTGGGTCCCCAGACCCTGGGG - Intronic
1061666724 9:132164337-132164359 CGCTGCCTCCCCGCGCCCGGCGG + Intronic
1061673836 9:132204242-132204264 CCCAGCTTCCCCAGACCCTGTGG + Intronic
1061808045 9:133147465-133147487 CGCTGCCCCCCCACAACCCAGGG + Intronic
1061918330 9:133768783-133768805 TGCTGTGTCCCCAGACCCAGAGG - Intronic
1062332241 9:136049889-136049911 CGCCGCCACCGCAGCCCCCGCGG + Exonic
1062542078 9:137045957-137045979 CGCTGCCTCCGCCCTCCCCGCGG - Exonic
1062696264 9:137877772-137877794 CGCCGCCTCACCCGACTCCGCGG - Exonic
1190929396 X:54935058-54935080 CACAGCCTCCCCAGGCCCCCAGG + Intronic
1197700389 X:129595207-129595229 TCCTGCCTCCCCAGGCCCCGTGG - Intergenic
1198100023 X:133415248-133415270 CGCTGCCCCGCGAAACCCCGAGG - Exonic
1198727363 X:139691830-139691852 CGCTGCCTCCCCAGCCCGGCCGG - Intronic
1201400314 Y:13597609-13597631 AGCAGCCTCCCCAGCCCCAGTGG - Intergenic