ID: 1064110152

View in Genome Browser
Species Human (GRCh38)
Location 10:12531613-12531635
Sequence CATTTTGCACAGAAAGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064110147_1064110152 -8 Left 1064110147 10:12531598-12531620 CCAAACCACGCCTCCCATTTTGC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG No data
1064110145_1064110152 19 Left 1064110145 10:12531571-12531593 CCAGGGAATCATCACAGTGGAAC No data
Right 1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064110152 Original CRISPR CATTTTGCACAGAAAGAGCG TGG Intronic
No off target data available for this crispr