ID: 1064119321

View in Genome Browser
Species Human (GRCh38)
Location 10:12605512-12605534
Sequence GAGTGGGCCCCTGAGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064119321_1064119324 -10 Left 1064119321 10:12605512-12605534 CCAGGCCACTCAGGGGCCCACTC 0: 1
1: 0
2: 2
3: 38
4: 249
Right 1064119324 10:12605525-12605547 GGGCCCACTCTGACCCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064119321 Original CRISPR GAGTGGGCCCCTGAGTGGCC TGG (reversed) Intronic
900104138 1:975030-975052 GGGTGGGTCCTTGTGTGGCCTGG + Exonic
900146680 1:1161695-1161717 GAGTGGGCATCAGAGTGGGCCGG + Intergenic
900192221 1:1356424-1356446 GGGTGGGCCCCCGAGGGCCCTGG + Intronic
900230409 1:1554251-1554273 GTGGGGGCCCCCGAGTGGTCCGG - Intronic
902264567 1:15252713-15252735 CCGTGGGCCCCTCAGAGGCCAGG + Intronic
902318862 1:15645575-15645597 GAGTGGGCCACTGGCTGGCCGGG + Intronic
904469972 1:30730137-30730159 GAGTGGGCCCTTCAGTGTGCTGG - Intergenic
905631622 1:39522001-39522023 GAGTCGGCCCTTGACTGGCCTGG + Intronic
905666131 1:39764171-39764193 GAGTCGGCCCTTGACTGGCCTGG - Intronic
905970751 1:42140528-42140550 GAGTGGGCCCATGAGTGGAATGG + Intergenic
906061533 1:42952339-42952361 GAGTGTGGGCCTGAGTGGCCCGG - Intronic
906692111 1:47799335-47799357 GAGTGACCCCCTTTGTGGCCAGG - Intronic
907158220 1:52353572-52353594 GCGGGAGCCTCTGAGTGGCCAGG - Exonic
907663877 1:56417359-56417381 GGGTGGGCCTCTGAGTGGGAGGG - Intergenic
911546558 1:99224664-99224686 GAGGGAGCCCATGAGTGGACGGG + Intergenic
915133758 1:153714951-153714973 GAGTCGGCCTCTGGGTGGCGGGG + Intergenic
915651338 1:157313215-157313237 CAGTGGGCTCCTGGGTGGCTAGG + Intergenic
917835460 1:178938445-178938467 CAGGGGGCTCCTGAGTGTCCTGG - Intergenic
917921683 1:179755872-179755894 GAATGGTCCTCTGAGGGGCCTGG - Intronic
921750851 1:218791921-218791943 GGGTGGGCCACAGAGTGCCCAGG - Intergenic
922555586 1:226529865-226529887 GAGTCGGCCCCTGACTGGCCTGG + Intergenic
922801681 1:228367460-228367482 GGGTGAGCCCCAGAGTAGCCGGG - Intronic
922882362 1:228990497-228990519 GTGTGGGCCCCTGATCGGCAAGG - Intergenic
924337847 1:243001100-243001122 GAGTTGGCCCCTCAGCTGCCAGG - Intergenic
1062829601 10:596966-596988 GAGTGGGCCCCGGGGTGCCCAGG + Intronic
1062834058 10:624532-624554 AAGTGGGGCCTTGAGTGGCTTGG + Intronic
1063224644 10:4004398-4004420 GGGTGGGGGCCTGAGTGTCCTGG + Intergenic
1064119321 10:12605512-12605534 GAGTGGGCCCCTGAGTGGCCTGG - Intronic
1066464861 10:35642198-35642220 GAGCGGACACCTGAGTGGCGCGG + Exonic
1067052183 10:43028073-43028095 CAGTGGGGGCCTGAGTGCCCTGG - Intergenic
1068310387 10:55266791-55266813 GAGTAGGCCGCTTAGTGGCTGGG - Intronic
1068395145 10:56450979-56451001 GAGGAGGTCCCTAAGTGGCCTGG - Intergenic
1069812191 10:71170256-71170278 ATGTGGGCTCCTGAGGGGCCAGG - Intergenic
1070594016 10:77819948-77819970 GAGTGGGCACCTTACTCGCCTGG - Exonic
1072630236 10:97140484-97140506 GAGTGGGCCCCCAAGTTGCCTGG + Intronic
1072670159 10:97423547-97423569 GACTAGGCCACTGGGTGGCCTGG + Intronic
1072805845 10:98423721-98423743 GTGCGGCCCCCTGGGTGGCCAGG - Intronic
1073070771 10:100791835-100791857 GTGTGGGCACCTGGGTGGACTGG + Intronic
1073472499 10:103731589-103731611 GAGGTGCCTCCTGAGTGGCCTGG - Intronic
1076706842 10:132307117-132307139 GACTGAGCCTCTGAGCGGCCGGG + Intronic
1076739860 10:132477808-132477830 GAGTGCGCTCCTGGGTGGCCTGG - Intergenic
1077101001 11:822300-822322 GAATGGGGCCCTTGGTGGCCGGG + Intronic
1077325442 11:1961999-1962021 AGGTGGGCTCCCGAGTGGCCTGG + Intronic
1077530978 11:3094588-3094610 GAGACGGCCCCTGAGGGACCAGG - Intronic
1077537747 11:3132569-3132591 GAGTGGGCGACAGAGTGGGCTGG - Intronic
1079612837 11:22454442-22454464 TAGTGGGGACCTCAGTGGCCAGG + Intergenic
1081867589 11:46367965-46367987 GAGAGGGCCCCTGAGGCACCAGG - Intronic
1083571595 11:63764466-63764488 GGCTGGGTCCCTGAGAGGCCCGG - Exonic
1084564431 11:69921117-69921139 GTCTGGAGCCCTGAGTGGCCCGG - Intergenic
1084963004 11:72727010-72727032 GTGTGGGCCACTGAGTGCCAAGG - Exonic
1085253660 11:75159920-75159942 GAGTGGGCAGGTGAGAGGCCAGG + Intronic
1085315669 11:75543486-75543508 GAGTTGACCGCTCAGTGGCCTGG + Intergenic
1088532046 11:110821037-110821059 GAGTGGGCCACAGAATGCCCAGG + Intergenic
1089688015 11:120169267-120169289 GAGCGCGCCCCCGTGTGGCCAGG + Intronic
1091203155 11:133798084-133798106 TAGAGGGTACCTGAGTGGCCAGG + Intergenic
1202808423 11_KI270721v1_random:17178-17200 AGGTGGGCTCCCGAGTGGCCTGG + Intergenic
1091442373 12:521418-521440 GACTGGGCCCCGGAAAGGCCAGG - Intronic
1091648456 12:2291337-2291359 GAGTAGGCCCTTGAGAAGCCAGG - Intronic
1092259664 12:6946187-6946209 GAGTGGGTCCCTCAGCGCCCTGG + Intergenic
1092515920 12:9212215-9212237 CACTGGGTCCCTGAGTGGGCAGG + Intergenic
1092732259 12:11545971-11545993 CAGTTGGCCCCTGAGCTGCCAGG + Intergenic
1093172600 12:15876160-15876182 GAGGGGGACCCGGAGTGGGCAGG - Intronic
1096215011 12:49793772-49793794 CTGTGGGCCCCGGAATGGCCTGG - Exonic
1096491721 12:52016242-52016264 GATTGGGCCCCTCACAGGCCAGG - Intergenic
1096495567 12:52037468-52037490 AGGTGGGCCCCGGAGAGGCCGGG + Intronic
1097300237 12:58010164-58010186 GTTAGGGGCCCTGAGTGGCCTGG + Intergenic
1103515060 12:121502339-121502361 GTGTGAGCCACTGTGTGGCCAGG - Intronic
1106121427 13:26862948-26862970 GGGAGGGCCCATGAGTGGCTTGG + Intergenic
1107535185 13:41322404-41322426 GAGTGGGCCTCTGAATGGGGTGG + Intronic
1108438194 13:50422088-50422110 CAGATGGCCACTGAGTGGCCAGG + Intronic
1111721052 13:91945660-91945682 GAGTGGGCCCTTGAGCTACCAGG - Intronic
1113695434 13:112342659-112342681 GAGTGGGGCCCTGAGACGCCTGG + Intergenic
1113760111 13:112840894-112840916 CAGAGGGCCCCAGAGTGGGCAGG - Intronic
1114847636 14:26343171-26343193 GAGAGGGCTCGTGAGTGGCAGGG - Intergenic
1117024663 14:51607426-51607448 GAGTTGGCACCTCAGTGGCAGGG - Intronic
1117347320 14:54846005-54846027 GACTGGGCCACAGAGAGGCCCGG + Intronic
1118440131 14:65804551-65804573 AAGGGGGCCCCTGTGTGGTCCGG + Intergenic
1120999262 14:90439776-90439798 GGCTGGGCCCGTGAGTGGACAGG + Intergenic
1122101725 14:99416868-99416890 GAGTGCGTCCCTGGGTTGCCTGG - Intronic
1122800488 14:104226989-104227011 GAGGTGGCCCCTGTGGGGCCTGG + Intergenic
1122825219 14:104367459-104367481 GAGAGAGCCCCTGAGAGGTCGGG + Intergenic
1122930807 14:104932378-104932400 GGGCGGGCCCCAGGGTGGCCAGG + Intronic
1123545080 15:21331687-21331709 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1124888078 15:33705795-33705817 GAGTGGGCCCTTGAGTAATCAGG - Intronic
1128428643 15:67569747-67569769 CAGTGGTCCCCAGAGTGCCCTGG - Intronic
1128619087 15:69133703-69133725 GAGTGGCACCCTGTGGGGCCTGG + Intergenic
1129724836 15:77896459-77896481 GAGTGGGGCCCAGAGAAGCCCGG - Intergenic
1131054846 15:89369092-89369114 GGCTGGGAGCCTGAGTGGCCGGG - Intergenic
1131573873 15:93566884-93566906 GAGTGGTCCCCTGAGTCAACAGG + Intergenic
1132045976 15:98563028-98563050 GAGAAGCCCCCTGAGTGGACAGG + Intergenic
1202953426 15_KI270727v1_random:58958-58980 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1132605989 16:793966-793988 GATGGGGCCTCTGAGTGTCCCGG + Intronic
1132685066 16:1158801-1158823 GAGTGGCGCCCTGCGGGGCCGGG - Intronic
1132685079 16:1158834-1158856 GAGCGGGGCCCTGTGGGGCCGGG - Intronic
1132786256 16:1658432-1658454 GGGTGGGCTCCTGAGAGGGCAGG + Intronic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1138651263 16:58463049-58463071 GGGTGGGACCCTGAGGGACCAGG + Intronic
1139633637 16:68245292-68245314 GAGGCGGGCCCTGATTGGCCGGG + Intronic
1140945491 16:79764633-79764655 GAGCGGGGGCCTGAGAGGCCAGG - Intergenic
1141400219 16:83740818-83740840 GAGTTGTCCAGTGAGTGGCCTGG - Intronic
1141726777 16:85794882-85794904 GAGTGGGCCCCTGCGGTGCCCGG + Intronic
1141881761 16:86864925-86864947 ACGTTGGCTCCTGAGTGGCCTGG + Intergenic
1142292005 16:89197459-89197481 GGGAAGGGCCCTGAGTGGCCAGG - Intronic
1143141301 17:4743337-4743359 GAGTGAGGCCCCGAGAGGCCAGG - Exonic
1143518060 17:7429883-7429905 GAGTGGGTCCAGGAGTGGGCAGG - Intergenic
1144453996 17:15404299-15404321 GTGTGGGCTCCAGAGTGGACTGG + Intergenic
1145868443 17:28255522-28255544 GAGTGAGCCCCTGGGAGGCCAGG - Intergenic
1147585889 17:41653896-41653918 GTGAGGGCCCCGCAGTGGCCAGG - Intergenic
1147978526 17:44261240-44261262 CAGTGGGGACCTGAGGGGCCTGG + Intronic
1148334309 17:46831576-46831598 GGGAGGGCCCCAGAGTGGCGGGG + Intronic
1148471558 17:47896573-47896595 GAGCGGGCACCGGGGTGGCCTGG + Intronic
1149303761 17:55329000-55329022 GAAGGGGGCACTGAGTGGCCAGG - Intergenic
1150648457 17:66994538-66994560 GACTGGGCCCCTGGGGGGCCAGG - Intronic
1151247295 17:72804740-72804762 GTGTGAGCCACTGCGTGGCCGGG - Intronic
1151322125 17:73358642-73358664 GAGTGGGCCCATGAGAGGAGGGG + Intronic
1152363183 17:79841743-79841765 GCGTGGGCCCCTGAGGGGCCTGG - Intergenic
1152740794 17:82017504-82017526 GTGTGGGCCCCTGAGGAGCCTGG + Intergenic
1156453745 18:37281227-37281249 GAGTGGGCCTCTGAGTGGTGAGG + Intronic
1157976117 18:52328848-52328870 GGGTTGGTCCCTGTGTGGCCAGG + Intergenic
1160316146 18:77849475-77849497 GAGAGGGCCCAAGAGTGGCCAGG - Intergenic
1160725213 19:614800-614822 GACTGCCCCCCTGAGAGGCCAGG - Intronic
1160936821 19:1600064-1600086 GAGAGCTCCCCTGAGTTGCCTGG + Intronic
1161040563 19:2108888-2108910 GGGTGTGGCCCTGAGAGGCCTGG + Intronic
1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG + Intronic
1161079863 19:2305402-2305424 GAGTGTGGCTGTGAGTGGCCGGG + Intronic
1161512122 19:4677660-4677682 GAGTGGGCCCTTGAAGTGCCTGG - Intronic
1161851664 19:6740601-6740623 CTGGGGGCCCCTGAGTGGCCAGG - Intronic
1162568531 19:11457516-11457538 TTGTGGGCCCCCGGGTGGCCGGG - Intronic
1163114547 19:15181079-15181101 CAGTGGGCTCCTGTGTAGCCGGG + Exonic
1163374369 19:16921425-16921447 GGGAGGGCCCCTGGGAGGCCGGG - Intronic
1163730453 19:18946409-18946431 GAGGGGGCACCTGAGAGGCCAGG - Intergenic
1163800029 19:19359035-19359057 GAGTCTGCCCCTGAGAGGGCTGG - Intergenic
1165060112 19:33201070-33201092 ATGTGGGTCCCTGAGTGGACGGG - Intronic
1165424191 19:35736992-35737014 GAGTGGGCCCCACAGGGGGCAGG + Intronic
1165838509 19:38773384-38773406 GAGTGTGCCACGGACTGGCCTGG - Intronic
1165841050 19:38789313-38789335 GAGTGTGCCACGGACTGGCCTGG + Intronic
1166671163 19:44710377-44710399 GATTGGGCCACTGGGTGGCCCGG + Intronic
1166998309 19:46730323-46730345 GGGAGGACCCCAGAGTGGCCAGG + Intronic
1167454312 19:49590594-49590616 GTGGGGGCCCGTGAGGGGCCAGG - Exonic
924977029 2:187188-187210 GTGGGGGCTCCTGTGTGGCCAGG + Intergenic
925103143 2:1266525-1266547 GAATGAGCTCCTGGGTGGCCGGG + Intronic
925878528 2:8331816-8331838 GGGTGGGCCCCTTAGTGAGCAGG - Intergenic
926044462 2:9699517-9699539 GAGTGACACACTGAGTGGCCCGG + Intergenic
926061560 2:9808036-9808058 GAGAGGGACCCTGGGTGGCAGGG - Intergenic
929471192 2:42194789-42194811 GAGTGAGCCACTGCTTGGCCAGG + Intronic
931551244 2:63449528-63449550 GACTGGGACCCTGAGGGGCTTGG + Intronic
932572672 2:72946128-72946150 GAGGGGGCCCCGGAGTGGGCAGG - Intronic
934660252 2:96139329-96139351 AGGTGGGGCCCTGAGTGACCTGG - Intergenic
935221790 2:101021467-101021489 GAGTGTGCACCAGAGTTGCCTGG - Intronic
936076225 2:109403481-109403503 GAGTGGGGCCCTGGAAGGCCAGG - Intronic
937812359 2:126213113-126213135 GAGAGAGCCCCAGAGTGACCTGG + Intergenic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
938193104 2:129300547-129300569 GAGTTGGGCCCGGGGTGGCCAGG + Intergenic
938739380 2:134216805-134216827 GAGTGGGATCCTGAGCGGGCTGG + Intronic
940174558 2:150864030-150864052 GAGTGGGCCCAGGTGTGGCTTGG - Intergenic
945255185 2:207797310-207797332 GAGTGTGCCCTTGAGTGCACAGG - Intergenic
947667255 2:231914163-231914185 CACTGGGCCCCTCAGTGTCCAGG + Intergenic
947869504 2:233425577-233425599 GAGAGGACCTCTGAGTGGCTGGG - Intronic
947910173 2:233795568-233795590 CAGTGGGCCCCTGAGTAGCGAGG + Intronic
948386790 2:237585636-237585658 GTTTAGGCCGCTGAGTGGCCAGG + Intronic
948402313 2:237692676-237692698 GCGCGGGTCCGTGAGTGGCCCGG + Intronic
948487726 2:238291365-238291387 GAGAGGGCCAGTGAGTGGACTGG - Intergenic
948629228 2:239291409-239291431 GAGGGGTCCCCTGGGTGGCGGGG + Intronic
948834692 2:240620379-240620401 GAGACGGCCCCTGAGTGCCCAGG + Intronic
1170830336 20:19834003-19834025 GAGTGAGACCCCCAGTGGCCTGG + Intergenic
1172096866 20:32464588-32464610 GCGTGTGCCCCTCAGTGCCCGGG + Intronic
1173595659 20:44257355-44257377 GAGTGGGCCCCTGGGTGGGGAGG - Intronic
1174052874 20:47779454-47779476 GAGAGGGCCCGAGAGTGGCTTGG - Intronic
1174552604 20:51372739-51372761 GAGATGGCCTCTGTGTGGCCCGG - Intergenic
1175184037 20:57167775-57167797 GTGTGGGGCCCAGAGTGGCCAGG + Intergenic
1175963674 20:62649518-62649540 GAGTGGGCCCTGCAGAGGCCAGG + Intronic
1178029716 21:28510366-28510388 GAATGGTCCCCTCAGTGACCTGG - Intergenic
1178690861 21:34748417-34748439 GAGTTGGCCCTTCTGTGGCCAGG + Intergenic
1179534210 21:42040818-42040840 GAGTAGACACCTGAGTGGCAGGG + Intergenic
1179991823 21:44952334-44952356 GAGTCACTCCCTGAGTGGCCAGG - Intronic
1180228874 21:46414465-46414487 GAGTGGGCGGCTGTGTGTCCAGG - Intronic
1180228913 21:46414615-46414637 GAGTGGGCGGCTGTGTGTCCAGG - Intronic
1180228953 21:46414771-46414793 GAGTGGGCGGCTGTGTGTCCAGG - Intronic
1180701846 22:17785501-17785523 GAGTGGTCCCCAAAGTAGCCAGG - Intergenic
1180845419 22:18978642-18978664 GAGTGGGCTCCTCAGATGCCTGG - Intergenic
1180996267 22:19967220-19967242 GATTGGGCTCCTGAGTCCCCTGG + Intronic
1183464661 22:37973550-37973572 GACTGGGGCCCTGAGGGGCTGGG + Exonic
1183731883 22:39622766-39622788 GTGTGGGCACCTGGGTGGGCGGG + Intronic
1184281109 22:43438098-43438120 GAGTGGGGCCCTGTGTGCTCAGG - Intronic
1184645181 22:45891479-45891501 GAGTGGGCCCCAGGGTGGGGGGG - Intergenic
1184889472 22:47371003-47371025 GAGTCGGCTCCTGAGTGTCTGGG - Intergenic
1185347369 22:50316521-50316543 CCGTGGGCTCCTGAGTGGCGAGG - Intronic
950727093 3:14923598-14923620 GAGCCGGCCCCTGAGAGACCTGG + Intronic
950891617 3:16409314-16409336 GAGTGTTCCCCTGAGTGAACAGG - Intronic
953147442 3:40291421-40291443 GAGTGGTCCACGGACTGGCCTGG + Intergenic
953470789 3:43164184-43164206 GAGTGGGATCCTGAGTCTCCTGG + Intergenic
954132986 3:48569567-48569589 GAGTGGGCCCACGTGTGGACTGG - Intronic
954720267 3:52555572-52555594 GTGTAGGCTCCTGAGTGACCTGG - Intronic
956835693 3:73094585-73094607 GCCTGAGCCCCTGAGTGGCTAGG + Intergenic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
961044032 3:123696545-123696567 GTGTGGGTGCCTGAGTGGCTGGG - Intronic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
963037827 3:141047856-141047878 CAGGGGGCCCCAGTGTGGCCTGG + Intergenic
966784848 3:183614048-183614070 GAGTGGGCCCTGGAGTGTACTGG + Intergenic
968290320 3:197533835-197533857 GAGTGGGACACTGGATGGCCAGG - Intronic
968448312 4:663503-663525 GAGGGGTCCACTGAGTGTCCAGG - Intronic
968592369 4:1465505-1465527 GAGAAGGTCCCTGAGTGGCCAGG + Intergenic
968763130 4:2452561-2452583 CAGTGGGCCTCACAGTGGCCTGG + Intronic
969243549 4:5917881-5917903 GCCTGGGCCCCTGCTTGGCCTGG - Intronic
969638251 4:8381900-8381922 GAGTGGGCCCCCGAGTGGGACGG + Intronic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
969900213 4:10342391-10342413 GAGTGTGGCCTGGAGTGGCCAGG + Intergenic
973162219 4:47032487-47032509 GAGTGGCCTCCCGAGGGGCCCGG + Intronic
976172862 4:82322682-82322704 GAGTGACACCGTGAGTGGCCTGG - Intergenic
981014135 4:139955885-139955907 GCCTGGGCCCCTGAGTGCCTAGG + Intronic
982716781 4:158817218-158817240 GAGAGGGACACTGAGTGGGCAGG - Intronic
986153090 5:5145829-5145851 GAGCATGCCCCTGAGTGGCTGGG + Intronic
986449582 5:7851062-7851084 GACTGGGCCCCTGGGCGGGCGGG - Exonic
988566518 5:32323603-32323625 GAGTCAGCCACTCAGTGGCCTGG - Intergenic
988771714 5:34439384-34439406 GAGTGGCCCACTGAGTGGGAGGG - Intergenic
989385621 5:40852278-40852300 AAGTGGACCCCTGAGAGTCCAGG + Exonic
991666847 5:69007936-69007958 CAGTGGGGCCATGAGTGCCCAGG - Intergenic
997586253 5:135045331-135045353 AAGTGGGCCCCTCACTGGGCTGG - Intronic
998601866 5:143592743-143592765 GAGAGGGCAACTGAGGGGCCAGG + Intergenic
999308471 5:150535888-150535910 GAGTGGGCCCCTGGAAGCCCAGG + Intronic
1001617639 5:173056246-173056268 GACTCAGCCCCTGATTGGCCGGG + Intergenic
1002428787 5:179191331-179191353 AAGAGGGGCCCTAAGTGGCCAGG + Intronic
1002538956 5:179893632-179893654 CAGTGGACACCTCAGTGGCCTGG - Intronic
1002586602 5:180252685-180252707 GAGACGGCCACTGGGTGGCCTGG + Intronic
1003955889 6:11164794-11164816 AAGGGGGCTCCTGAGTGGCCGGG + Intergenic
1005955858 6:30662938-30662960 GTGTGGCCGCCCGAGTGGCCCGG - Exonic
1006091965 6:31633571-31633593 GAGAGGGGCCCTGAGGGGCTTGG - Exonic
1006314015 6:33279736-33279758 GAGCAGGCCCCTGAATGCCCAGG - Intronic
1006742705 6:36320800-36320822 GGGTGGGGCCAGGAGTGGCCAGG + Intronic
1007570920 6:42890474-42890496 CAGTGGGCCCCTGAGGTTCCAGG - Exonic
1010420571 6:75670059-75670081 GAGTAGCCTCCTGAGTAGCCGGG + Intronic
1011517306 6:88167160-88167182 GAGCGGGGCCCCGGGTGGCCGGG - Intergenic
1013416082 6:109925908-109925930 GTGTGGGCTTCAGAGTGGCCAGG - Intergenic
1015357591 6:132297375-132297397 GTGTGGGCAGCTGAGCGGCCTGG - Intronic
1016764348 6:147775166-147775188 GACTGGGTCCCTGCGAGGCCTGG + Intergenic
1017410858 6:154166276-154166298 AAGTTGGCCCCCCAGTGGCCAGG + Intronic
1022485155 7:30771930-30771952 GAGTGGGACCCTGACTTGCGTGG - Intronic
1023758867 7:43445060-43445082 AAGTGGCCCCCGGAGTGGCCAGG - Exonic
1023830620 7:44036991-44037013 GAGTGCCCCCCAGAGAGGCCAGG - Intergenic
1025099579 7:56123626-56123648 CAGTGGGCTCAGGAGTGGCCAGG - Intergenic
1029740949 7:102491305-102491327 GAGTGCCCCCCAGAGAGGCCAGG - Intronic
1029758943 7:102590478-102590500 GAGTGCCCCCCAGAGAGGCCAGG - Intronic
1031666601 7:124491886-124491908 GAGTAGCCTCCTGAGTGGCTAGG + Intergenic
1032016971 7:128386434-128386456 GACTGGGCCACAGAGTGCCCAGG + Intergenic
1032094682 7:128932148-128932170 GACTGGGCCCCTGAGTGTGCCGG - Intergenic
1032240516 7:130155293-130155315 GAGTGGGCCTGTCAGTGCCCAGG - Intergenic
1032468271 7:132160520-132160542 GTGTGGGCTCCTGGGTGGACTGG + Intronic
1032548042 7:132759706-132759728 GAGTGGGTCCCAGAGAGGGCTGG + Intergenic
1034946349 7:155264585-155264607 GAGTGGGCCCCTGTGCGAACAGG - Intergenic
1035263378 7:157675389-157675411 GGGTGAGCCCCTGTGTGGTCCGG - Intronic
1035266386 7:157692259-157692281 GAGTTGGCCCCGGAGGGGCCGGG - Intronic
1035719767 8:1783219-1783241 ATGTGGGCCGCTGAGTGGGCCGG - Exonic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1037440654 8:18912921-18912943 AAGTGGGCTGCTGAGTGGCAAGG + Intronic
1037848530 8:22306468-22306490 TTGTGGGGCCCTGAGTGTCCTGG + Intronic
1039473992 8:37829787-37829809 GTGTGGGCTCATGGGTGGCCTGG - Intronic
1039936651 8:42051827-42051849 GAGTGGGCCCTGGAGCGGCTCGG + Intronic
1040676431 8:49756581-49756603 GAGTGGGACCCCGAGTGAGCAGG + Intergenic
1040745389 8:50635624-50635646 GAGTGGACTCGTCAGTGGCCTGG - Intronic
1041048099 8:53906425-53906447 GAGTGGCCCCCTAAGTGTGCTGG + Intronic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1048738431 8:137527563-137527585 GAGTGGTCTCCAGAGTGGCAAGG + Intergenic
1049657623 8:143805706-143805728 GAGCGGGGCCATGTGTGGCCTGG - Intronic
1049706370 8:144045012-144045034 GTGGGGGCCCCTGCGTGCCCTGG + Intronic
1052881871 9:33605843-33605865 GCCTCGGCCCCTGAGTAGCCGGG + Intergenic
1053003595 9:34590725-34590747 GCCTGGGCCTCTGAGGGGCCGGG + Intergenic
1055454013 9:76456399-76456421 GAGAGGGCCCCTGGTTGGCTGGG - Intronic
1056244225 9:84678310-84678332 CAGTGGGTCTCTGAGTGACCAGG - Intronic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1059416153 9:114163709-114163731 GATTGGGCCCCTGGGAGGGCAGG + Intronic
1059623298 9:116033140-116033162 GAGTGGCCCCCTGAGTGCTCAGG + Intergenic
1060114371 9:120928906-120928928 GAATGAGCCCCTGCGGGGCCGGG + Intronic
1060597412 9:124856662-124856684 CACTGGGCCCCTAAGTGGCCTGG - Intronic
1060983850 9:127808708-127808730 GAGTGGGCAGCTGAGTGGGCAGG + Intronic
1061268749 9:129524257-129524279 GTGTGGGTCCCTTGGTGGCCAGG - Intergenic
1062011195 9:134267722-134267744 GAGGGGGCTGCAGAGTGGCCAGG + Intergenic
1062131034 9:134893255-134893277 GCGAGGGGCCCTGAGTGCCCAGG - Intergenic
1062309861 9:135929837-135929859 GAGAGAGCCCCTGGGTGGGCGGG + Intergenic
1062387361 9:136318164-136318186 GAGTGGGCTCCTGGGAGGCCTGG + Intergenic
1062525873 9:136977929-136977951 GCGTGGGCGCGTGTGTGGCCCGG - Intronic
1185627371 X:1492259-1492281 GGGTGGCCCCCTAACTGGCCAGG - Intronic
1185782454 X:2861429-2861451 GGGTGGGGCCCTGTGTAGCCAGG - Intronic
1190015518 X:46823667-46823689 GAATGGGCCCCTCAGTGACAGGG - Intergenic
1190728779 X:53210651-53210673 GAGTGGGACCCTGGGGAGCCAGG - Intronic
1192509562 X:71713833-71713855 GACTGGGCCCCTGAGGGGCGGGG + Intergenic
1192517135 X:71767720-71767742 GACTGGGCCCCTGAGGGGCGGGG - Intergenic
1197833696 X:130672414-130672436 CAGTGGGCCACTTAGGGGCCTGG + Intronic