ID: 1064120110

View in Genome Browser
Species Human (GRCh38)
Location 10:12611230-12611252
Sequence GGGTTGCCTGCACTTTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064120110_1064120116 5 Left 1064120110 10:12611230-12611252 CCCCATCAAAGTGCAGGCAACCC No data
Right 1064120116 10:12611258-12611280 ACTCCACCTCCACTAAACGCAGG No data
1064120110_1064120120 23 Left 1064120110 10:12611230-12611252 CCCCATCAAAGTGCAGGCAACCC No data
Right 1064120120 10:12611276-12611298 GCAGGCCCTGTGCCCATCCCTGG No data
1064120110_1064120121 27 Left 1064120110 10:12611230-12611252 CCCCATCAAAGTGCAGGCAACCC No data
Right 1064120121 10:12611280-12611302 GCCCTGTGCCCATCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064120110 Original CRISPR GGGTTGCCTGCACTTTGATG GGG (reversed) Intronic
No off target data available for this crispr