ID: 1064120949

View in Genome Browser
Species Human (GRCh38)
Location 10:12618523-12618545
Sequence CCCCCCACGAGTCTTTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064120949 Original CRISPR CCCCCCACGAGTCTTTGAAG GGG (reversed) Intronic
901211882 1:7531363-7531385 CCCCCAGCGAGTCTGTGAGGTGG - Intronic
901870778 1:12138165-12138187 CTCCCCACCAGTCTCTGAACTGG - Intronic
905729860 1:40289864-40289886 CCTCCCACCTGACTTTGAAGCGG - Intronic
917865500 1:179190579-179190601 CCCCCCACGTCTCTGTGGAGGGG - Intronic
920571221 1:207019434-207019456 CCACCCACAATTCTTTGAAAAGG + Exonic
922994017 1:229941639-229941661 CCACCCACAAGGATTTGAAGTGG + Intergenic
1064120949 10:12618523-12618545 CCCCCCACGAGTCTTTGAAGGGG - Intronic
1074127506 10:110540969-110540991 CCCCTCACTGGTCCTTGAAGTGG - Intergenic
1081933726 11:46890200-46890222 CCCCCCAGGAGCCTTGGTAGAGG - Intronic
1088990373 11:114948469-114948491 CCCCCCACCAGCCTTAGGAGTGG - Intergenic
1092406370 12:8224512-8224534 GCCCCCAAGAGTCTCTCAAGGGG + Intronic
1095924209 12:47562389-47562411 CCCCCTACCACTGTTTGAAGTGG + Intergenic
1101232657 12:102756969-102756991 CCCCCCGGGAGACTTTGCAGGGG - Intergenic
1105272463 13:18891283-18891305 CCCCTCATAAGTCTTTGATGGGG - Intergenic
1108912588 13:55576058-55576080 TCCCTCATGAGTTTTTGAAGTGG - Intergenic
1112767334 13:102759790-102759812 CTACCCACTAGACTTTGAAGGGG - Intergenic
1121768040 14:96504318-96504340 TCCCCCAACATTCTTTGAAGAGG + Intronic
1132180562 15:99749758-99749780 CCGGCCACCAGTCTATGAAGTGG - Intergenic
1132952446 16:2571171-2571193 CCCACCACCAGTCTCTGAACAGG - Intronic
1132961905 16:2628999-2629021 CCCACCACCAGTCTCTGAACAGG + Intergenic
1133172302 16:3988633-3988655 CCCCCCACCTGCCTTGGAAGGGG - Intronic
1133378949 16:5313861-5313883 CCACCCATAAGTCTTTGAAATGG - Intergenic
1141536218 16:84682172-84682194 CTCCCCACCTGTCTTTGAGGTGG + Intergenic
1156849727 18:41712450-41712472 CCCCCAAAGACTCTTTAAAGTGG + Intergenic
1161026077 19:2038034-2038056 CCCCCCAGGGGTCTTTGGAAGGG + Exonic
1164771445 19:30812375-30812397 CCCCCCCCGAGTCCTTGAAAAGG + Intergenic
1165255655 19:34576183-34576205 CCACCCAGGAGCCTTTCAAGGGG - Intergenic
1165504244 19:36214804-36214826 GCGCCCACGAGTCTTCGGAGAGG + Exonic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
943714707 2:191137776-191137798 CCCACCACGATTTATTGAAGAGG - Intronic
1175588733 20:60169811-60169833 TCCCCCATCAGTCATTGAAGGGG + Intergenic
1176293035 21:5056233-5056255 GCACCCCCGAGTCTGTGAAGAGG - Intergenic
1179864225 21:44207417-44207439 GCACCCCCGAGTCTGTGAAGAGG + Intergenic
1182174079 22:28265359-28265381 CTCCCAACCAGTCTTTGTAGAGG + Intronic
949905126 3:8852669-8852691 CCCCACAAGAGTCTCTGTAGAGG - Intronic
950448341 3:13051274-13051296 CTCCCCAGGAGGCTGTGAAGTGG - Intronic
950484812 3:13266880-13266902 TCCCCCACCAGGCTATGAAGTGG + Intergenic
956520703 3:70100502-70100524 CCCCCCCCCACTCTTTCAAGTGG - Intergenic
989568489 5:42924389-42924411 CCCGCGACCAGTCTTCGAAGAGG - Intergenic
993361874 5:86987660-86987682 AACCCCAAGAGTCTATGAAGTGG - Intergenic
1001403504 5:171460400-171460422 CACCCCACCAGCCTTTGAGGTGG + Intergenic
1009974588 6:70659419-70659441 CCCCCCACCAGTCTTTTGACAGG - Intergenic
1012125851 6:95427488-95427510 ATCCCCACGAGTCATGGAAGGGG + Intergenic
1022499985 7:30876768-30876790 CCCTCCAAGAATCTTTGCAGGGG - Intronic
1023758017 7:43438111-43438133 CTCTCCAGGAGTCTTTGAACGGG - Exonic
1032389269 7:131545212-131545234 CCCCTCAAGAGTGTTTGCAGTGG - Intronic
1036573378 8:10001799-10001821 CTCCCAACAAGTCTATGAAGTGG - Intergenic
1036846747 8:12175451-12175473 GCCCCCAAGAGTCTCTCAAGGGG + Intergenic
1036868112 8:12417770-12417792 GCCCCCAAGAGTCTCTCAAGGGG + Intergenic
1037901052 8:22690053-22690075 CCCCTCTCGAGTCTTCGAGGGGG + Exonic
1039770054 8:40676779-40676801 CCCACAATGAGTCTTTTAAGGGG - Intronic
1043431973 8:80204090-80204112 CCCACCAGGTGTCTTTGAATTGG - Intronic
1045289065 8:100816308-100816330 CCTCCCAGGAGCCTTTGAACAGG - Intergenic
1045731980 8:105252822-105252844 CCCCCCATCATTCATTGAAGAGG + Intronic
1045889928 8:107143631-107143653 CCCCCCAAAATTCTATGAAGTGG + Intergenic
1050093038 9:2034750-2034772 CTCCCCACTAGTATTTGAACAGG + Intronic
1062552951 9:137098504-137098526 CCCCCCAGGTGTCTCTGAGGTGG + Intronic
1197854654 X:130902445-130902467 CCCCCACCAGGTCTTTGAAGTGG - Intronic