ID: 1064121219

View in Genome Browser
Species Human (GRCh38)
Location 10:12621936-12621958
Sequence AACCTGGGTTTCACTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064121219_1064121228 10 Left 1064121219 10:12621936-12621958 CCAGGTGGAGTGAAACCCAGGTT 0: 1
1: 0
2: 2
3: 18
4: 131
Right 1064121228 10:12621969-12621991 CTTCCATGGTCACCTGCTCGGGG No data
1064121219_1064121223 -4 Left 1064121219 10:12621936-12621958 CCAGGTGGAGTGAAACCCAGGTT 0: 1
1: 0
2: 2
3: 18
4: 131
Right 1064121223 10:12621955-12621977 GGTTTCCCACTAGGCTTCCATGG No data
1064121219_1064121227 9 Left 1064121219 10:12621936-12621958 CCAGGTGGAGTGAAACCCAGGTT 0: 1
1: 0
2: 2
3: 18
4: 131
Right 1064121227 10:12621968-12621990 GCTTCCATGGTCACCTGCTCGGG No data
1064121219_1064121226 8 Left 1064121219 10:12621936-12621958 CCAGGTGGAGTGAAACCCAGGTT 0: 1
1: 0
2: 2
3: 18
4: 131
Right 1064121226 10:12621967-12621989 GGCTTCCATGGTCACCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064121219 Original CRISPR AACCTGGGTTTCACTCCACC TGG (reversed) Intronic
911928128 1:103863489-103863511 AACCTGAGTTTCAATTCACCAGG + Intergenic
911928631 1:103870811-103870833 AACCTGTGTTTTGATCCACCAGG + Intergenic
913106473 1:115618173-115618195 ATTCTGGGTTTCACTCCCCAGGG - Intergenic
913237062 1:116794494-116794516 ATCTTGGGTCTCAGTCCACCTGG - Intergenic
913237281 1:116795843-116795865 ATCTTGGGTCTCAGTCCACCTGG - Intergenic
921236103 1:213132426-213132448 AACCTTTGTTTCAGTCCTCCTGG + Intronic
922186281 1:223277656-223277678 AGCCTGGGTTGCACACCACCAGG + Intronic
924826892 1:247549143-247549165 CTCCTGAGTTTCACTCCACTTGG - Exonic
1063670647 10:8096949-8096971 AACCTGGGTTGAAGTCCACAAGG + Intergenic
1064121219 10:12621936-12621958 AACCTGGGTTTCACTCCACCTGG - Intronic
1070561046 10:77566735-77566757 CACCTGGGCTTGCCTCCACCCGG - Intronic
1070599709 10:77857164-77857186 AACCTGGCTTTCACACCTCCAGG + Intronic
1070810934 10:79297864-79297886 ACCCTGGGGCTCACCCCACCTGG - Intronic
1078145595 11:8719998-8720020 AACCTTGGCTTCTATCCACCAGG + Intronic
1081386240 11:42476924-42476946 ATCCTGGATTTCACACCAACTGG + Intergenic
1082779487 11:57275666-57275688 TCTCTGGCTTTCACTCCACCAGG - Intergenic
1084154701 11:67307074-67307096 CACCTGGGTGTCACTCCAGAGGG - Exonic
1084925497 11:72508170-72508192 AACCTGGGATTCAATCACCCGGG - Intergenic
1085923141 11:80982441-80982463 AACCTGGGTATGACTCCACAGGG - Intergenic
1087127230 11:94640087-94640109 AACCTGGGATTCAGTTCGCCAGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089942716 11:122436347-122436369 AACCTGGGTCACACTCTGCCAGG + Intergenic
1090624181 11:128591524-128591546 TATCTGGGTTTCACTCTACTTGG - Intergenic
1091723625 12:2830812-2830834 AATTCGGGTTTCCCTCCACCAGG + Exonic
1096653184 12:53072318-53072340 TCCCTGAGTTCCACTCCACCAGG + Intronic
1097144397 12:56929978-56930000 AAACAGGGTTTCACTCACCCTGG + Intronic
1099150681 12:79109095-79109117 AACCTGGGATTCAATCTGCCAGG - Intronic
1101864591 12:108511190-108511212 AAACTGGGTCTGACCCCACCAGG + Intergenic
1103994414 12:124819827-124819849 ACCCTGGGTCGCACTCCACGGGG + Intronic
1108043952 13:46365488-46365510 AACCTGTGTTTCATTCCACATGG + Intronic
1111855412 13:93631220-93631242 TACCTGGGATTCAATCCACAAGG - Intronic
1113526324 13:110980741-110980763 AACTTGGGTTTCCCTTAACCAGG - Intergenic
1123120663 14:105914913-105914935 GACCTGGGTTTCACCTGACCTGG - Intergenic
1123403374 15:20006460-20006482 GACCTGGGTTTCACCTGACCTGG - Intergenic
1123512712 15:21013114-21013136 GACCTGGGTTTCACCTGACCTGG - Intergenic
1127932020 15:63603219-63603241 ATCTTGGGCTTCAGTCCACCTGG - Intergenic
1131070445 15:89462386-89462408 AGCCTGAGTTTCTCTCCACAGGG - Intergenic
1131284133 15:91043559-91043581 AACCTGGGTTTCCTTTCAGCTGG + Intergenic
1132957492 16:2603285-2603307 AAGCTCGGTTTCACTCCCTCCGG + Intergenic
1133496431 16:6322614-6322636 AACCTGGGTTTCAGTGGAACAGG + Intronic
1137049967 16:35700910-35700932 AACCTGGGTTTTGATTCACCAGG + Intergenic
1137050537 16:35709176-35709198 AACCTGTGTTTCAATTCACCAGG + Intergenic
1138370446 16:56522439-56522461 AGCTTGGGTTTTACTCCAGCAGG + Intergenic
1146194508 17:30800076-30800098 CACATGGCTGTCACTCCACCTGG - Intronic
1147020625 17:37529649-37529671 AAACTGGCTTGCACTTCACCTGG + Intronic
1148226897 17:45905271-45905293 CTCCTGGGCTTCTCTCCACCGGG + Intronic
1148463558 17:47851382-47851404 AACCTGGGAATCACCCCACCCGG - Intronic
1148572368 17:48680439-48680461 AACCTGGGAATCACCCCACGTGG - Intergenic
1148796015 17:50197136-50197158 AACCTGGGCTTCACTGCACTTGG - Intronic
1149858765 17:60108467-60108489 AACCTGGATTGCAAGCCACCTGG + Intergenic
1151943460 17:77306684-77306706 AATCAGGGTTTCCCTACACCAGG - Intronic
1154470197 18:14693263-14693285 AAACTGGGCTTCTCTCCAACTGG + Intergenic
1156179165 18:34582648-34582670 AACCTGTGTTTCTCTCCTCAGGG + Intronic
1159630499 18:70744092-70744114 AACCTGGGTTTCACACCCCCAGG - Intergenic
1161024044 19:2026923-2026945 AGCCCGGGCTTCTCTCCACCTGG - Intronic
1162474392 19:10891356-10891378 AACCTGGATCTTACTGCACCTGG + Intronic
1162585460 19:11555525-11555547 AACCTGAGTGTCACTCCTCCTGG - Intronic
1164379748 19:27721987-27722009 AACCTGTGTTTTACTTCACCAGG - Intergenic
1164479630 19:28601483-28601505 GTCCTGGCTTCCACTCCACCTGG + Intergenic
1164865709 19:31602633-31602655 AACCTGGGTTCTTCTCCACTTGG + Intergenic
1168192722 19:54751511-54751533 AAGCTGGGTCTCCCTCCATCTGG + Intronic
927645893 2:24876838-24876860 CACATGGGTTTCTCTGCACCAGG + Intronic
940686453 2:156857069-156857091 AACCTGAGTTTCTCTGCACAAGG - Intergenic
942149307 2:173058755-173058777 GACCTGGGTTTGACTCAATCAGG + Intergenic
942403785 2:175631096-175631118 AGCCTGGGCTTGACTCCAGCCGG - Intergenic
945154980 2:206828878-206828900 ACCCTTGGATTGACTCCACCTGG + Intergenic
948074707 2:235156757-235156779 AACCTGGCAGACACTCCACCAGG - Intergenic
949071489 2:242027725-242027747 AAGATGGGTTTGAATCCACCAGG + Intergenic
1171343466 20:24448012-24448034 CCTCTGGGTTTCACCCCACCAGG - Intergenic
1176673683 21:9757399-9757421 ACCCTGGGTTTTACACCACGGGG + Intergenic
1176804298 21:13464602-13464624 AAACTGGGCTTCTCTCCATCTGG - Intergenic
1178325399 21:31641542-31641564 TAGCTGGTTTTCACTCCACTTGG - Intergenic
1180942663 22:19669675-19669697 GAGCTGGGTTTCACTTCCCCAGG - Intergenic
1184068026 22:42131136-42131158 AACCAGGGTTTCAGTGGACCCGG + Intergenic
949878845 3:8645706-8645728 AACCTGGGATTGCCTTCACCAGG + Intronic
953378924 3:42452014-42452036 AACCTGGGATTCAATCTGCCAGG - Intergenic
956168443 3:66413816-66413838 TACCTGGGTTTCACCTCCCCTGG - Intronic
957492696 3:80949719-80949741 AATCTGTGTTTCAATTCACCAGG - Intergenic
957493086 3:80954824-80954846 AACCTGTGTTTTAATTCACCAGG - Intergenic
961267492 3:125655912-125655934 AACCTGTGTTTTAATTCACCAGG - Intergenic
961267735 3:125659278-125659300 AACCTGTGTTTAAATTCACCAGG - Intergenic
968050948 3:195654610-195654632 AAGATGGGTTTGAATCCACCAGG + Intergenic
968104877 3:195993728-195993750 AAGATGGGTTTGAATCCACCAGG - Intergenic
968303172 3:197631312-197631334 AAGATGGGTTTGAATCCACCAGG - Intergenic
968695455 4:2023616-2023638 CACCTGGTTTTTACCCCACCTGG - Intronic
970081227 4:12288812-12288834 AACCTGGGTTTTCATTCACCAGG - Intergenic
977575571 4:98670626-98670648 AACCTGGGTCAGACTACACCAGG + Intergenic
982053307 4:151525265-151525287 AAACTGGCTTTCACTCCACATGG + Intronic
982266093 4:153539587-153539609 TATCAGTGTTTCACTCCACCAGG - Intronic
984706840 4:182853505-182853527 CAGCTGGGTTTTACTCCACAAGG + Intergenic
985507572 5:292622-292644 AAGATGGGTTTGAATCCACCAGG + Intronic
985740404 5:1612506-1612528 AAGATGGGTTTGAATCCACCAGG - Intergenic
986065473 5:4230100-4230122 ATTCAGGGCTTCACTCCACCCGG - Intergenic
986770106 5:10965081-10965103 AACCTGGATTGTACTCCACTGGG - Intergenic
987892787 5:23903271-23903293 AACCTGTGTTTTAATTCACCAGG + Intergenic
987892951 5:23905516-23905538 AACCTGTGTTTCTATTCACCAGG + Intergenic
988092682 5:26563195-26563217 AAGCTTTGGTTCACTCCACCAGG + Intergenic
992185451 5:74239992-74240014 AACAGGGGTCTAACTCCACCTGG + Intergenic
992326397 5:75664221-75664243 AACCTGGATTGCTGTCCACCTGG + Intronic
992610640 5:78505354-78505376 AACCTGTGATTTACTCCGCCAGG + Intronic
994228155 5:97278923-97278945 ATCCATGGTTTCACTTCACCTGG + Intergenic
995433134 5:112104909-112104931 AGCCGGGGTTCCACTCAACCTGG + Intergenic
998206702 5:140162435-140162457 CACCTGCGGTTCCCTCCACCTGG + Intergenic
999080009 5:148834483-148834505 TACCTGGGTTTCACTCCAGTGGG - Intergenic
1000373949 5:160562050-160562072 AACTTGGGCTAGACTCCACCAGG - Intergenic
1000421227 5:161040123-161040145 AACCTGTGTTTCATTTCACCAGG + Intergenic
1002184950 5:177450016-177450038 CACCCGGGCTTCACACCACCTGG + Intronic
1002270690 5:178070013-178070035 AACCAGAGTGTCCCTCCACCAGG - Intergenic
1004425946 6:15507257-15507279 AACCTGGGATTCTCTCGTCCAGG + Intronic
1004695424 6:18028555-18028577 AACTTGTTTATCACTCCACCTGG + Intergenic
1006981976 6:38154332-38154354 AACATGGGCTTCGCTCCCCCAGG - Exonic
1007132099 6:39484884-39484906 AATCTGGGTTTGCCTCCCCCAGG + Intronic
1008172614 6:48227715-48227737 GACCTGGGATTCACATCACCGGG + Intergenic
1009907466 6:69887829-69887851 AACCTGGGATTCAATCAGCCTGG - Intronic
1010760262 6:79714476-79714498 CACCTGGGGTTCCCTTCACCTGG + Intergenic
1011590465 6:88965963-88965985 AACCTGGGATTCAGTCTACCAGG + Intergenic
1011726483 6:90215276-90215298 ACCCTGGGTTTCCATCCCCCTGG + Intronic
1012636131 6:101544430-101544452 AACCTGGTTTTCATTCCCCCGGG - Intronic
1013275093 6:108577377-108577399 AACCTCGGTTTCACTTGTCCTGG + Intronic
1013386078 6:109632592-109632614 CCCCTGGGTTTCACTTCTCCTGG - Intronic
1017290537 6:152730376-152730398 ATCTTGGGTTTCAATCCACCGGG - Intergenic
1021572783 7:22082854-22082876 AACCTGGATTTGACTCTTCCCGG - Intergenic
1021597924 7:22336713-22336735 AACCTGGGATTCAATCTGCCAGG + Intronic
1022037933 7:26551401-26551423 TTCCTGGTTTTCACTCCACATGG - Intergenic
1024673079 7:51614099-51614121 ATCCTTGGTTTCACTTCAACTGG - Intergenic
1027193835 7:76014375-76014397 AGACTGGGCTTCACTCCATCTGG + Intronic
1028647887 7:93119079-93119101 AACCTGGGTTTCACTTTGCATGG + Intergenic
1033345403 7:140522226-140522248 AACCTGGGTAACCCTCCTCCTGG - Intronic
1036698018 8:10991609-10991631 AACCTGGGTTACACTTCGCCTGG - Intronic
1038238453 8:25784946-25784968 AACCTAGGAATCATTCCACCTGG - Intergenic
1038948481 8:32388024-32388046 AACCTGGCTTTCAGGTCACCTGG - Intronic
1039806919 8:41008051-41008073 TACCTGGGGTTTACTCCTCCAGG - Intergenic
1040585676 8:48738819-48738841 AACCTGGGGTTCATTCCTGCTGG - Intergenic
1046398125 8:113667781-113667803 AACCTGGGTTTTACACTACATGG + Intergenic
1049559341 8:143300764-143300786 AGCCTGGACTTCACTCAACCTGG + Intergenic
1050458396 9:5856016-5856038 AACCTGGGCTTCAATCCACCTGG - Intergenic
1052347960 9:27428917-27428939 AAGCTGGCTTTCCCACCACCTGG + Intronic
1052693576 9:31848675-31848697 AACCTGGGATTCAAGCCGCCAGG + Intergenic
1052974415 9:34400748-34400770 AAACTGGGTCTCTCTCCACCCGG - Exonic
1053289250 9:36869104-36869126 ACCCTGAGGGTCACTCCACCTGG - Intronic
1062485941 9:136775673-136775695 AAGATGGGTTTGAATCCACCAGG - Intergenic
1191239626 X:58174231-58174253 AACCTGTGTTTTAATTCACCAGG + Intergenic
1191244723 X:58217574-58217596 AGCCTGTGTTTCAATTCACCAGG + Intergenic
1191245076 X:58222029-58222051 AACCTGTGTTTTGTTCCACCTGG + Intergenic
1192295216 X:69840366-69840388 AACCTTGCTTTCACTCCAGTGGG - Intronic
1198994156 X:142554561-142554583 AACTGGGGTTTCATCCCACCAGG + Intergenic
1199505091 X:148552464-148552486 TACCTGGGGTTCTATCCACCTGG + Intronic
1199919004 X:152376346-152376368 AAATTGGGTTTCACTCAAGCAGG - Intronic
1202168113 Y:22014036-22014058 ACCCTGGGTTTCACCCCAAAGGG + Intergenic
1202223248 Y:22572332-22572354 ACCCTGGGTTTCACCCCAAAGGG - Intergenic
1202319867 Y:23623328-23623350 ACCCTGGGTTTCACCCCAAAGGG + Intergenic
1202550901 Y:26046728-26046750 ACCCTGGGTTTCACCCCAAAGGG - Intergenic