ID: 1064122998

View in Genome Browser
Species Human (GRCh38)
Location 10:12635472-12635494
Sequence AGAGCTCCTGCACTGCGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064122998_1064123004 7 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123004 10:12635502-12635524 AAAGAACTCTGGTCTGGGGGAGG No data
1064122998_1064123005 8 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123005 10:12635503-12635525 AAGAACTCTGGTCTGGGGGAGGG No data
1064122998_1064123001 2 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123001 10:12635497-12635519 GATTCAAAGAACTCTGGTCTGGG No data
1064122998_1064123006 11 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123006 10:12635506-12635528 AACTCTGGTCTGGGGGAGGGTGG No data
1064122998_1064123000 1 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123000 10:12635496-12635518 AGATTCAAAGAACTCTGGTCTGG No data
1064122998_1064123007 14 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123007 10:12635509-12635531 TCTGGTCTGGGGGAGGGTGGAGG No data
1064122998_1064123002 3 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123002 10:12635498-12635520 ATTCAAAGAACTCTGGTCTGGGG No data
1064122998_1064123003 4 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123003 10:12635499-12635521 TTCAAAGAACTCTGGTCTGGGGG No data
1064122998_1064122999 -4 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064122999 10:12635491-12635513 CTCTTAGATTCAAAGAACTCTGG No data
1064122998_1064123008 21 Left 1064122998 10:12635472-12635494 CCACGGCGCAGTGCAGGAGCTCT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1064123008 10:12635516-12635538 TGGGGGAGGGTGGAGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064122998 Original CRISPR AGAGCTCCTGCACTGCGCCG TGG (reversed) Intronic
902403721 1:16172046-16172068 AGAGCTGCTGGACTGAGCTGAGG - Intergenic
903827318 1:26155577-26155599 AGAACACCTGCACTGTGCCATGG - Intergenic
904004677 1:27357525-27357547 AGAGCTGCTGCGCTGCCTCGGGG - Exonic
904772307 1:32886956-32886978 AGAGCTCCTCCAGTGCCCCCTGG - Intronic
905006179 1:34712232-34712254 AGAGCTCATTCTCTGCCCCGTGG - Intergenic
909691219 1:78409739-78409761 AGAGCTTCTGCACTGTGCTGGGG - Intronic
912092159 1:106092647-106092669 AGAGCCACTGCACTGCACCTCGG - Intergenic
915247572 1:154567636-154567658 AGAACTCCTCCACCGTGCCGTGG + Intergenic
922334052 1:224604816-224604838 TGAGCTCCTGTACTGTGCCCAGG + Intronic
924652271 1:245940249-245940271 AGAGCAGGTGCACTGCGCTGGGG - Intronic
1064122998 10:12635472-12635494 AGAGCTCCTGCACTGCGCCGTGG - Intronic
1072151765 10:92689938-92689960 AGAGCTGCTGGCCCGCGCCGCGG - Exonic
1076836698 10:133024612-133024634 AGAGCTCCTGCATTGTCTCGGGG + Intergenic
1078209651 11:9260159-9260181 AGAGCTTCTGCACAGAGCCTGGG + Intronic
1078397954 11:10998704-10998726 ACAGCCCCTGCACTGCCCCTGGG - Intergenic
1078425291 11:11244788-11244810 GGAGCTCCTGCTCTGTGCCAGGG - Intergenic
1079201782 11:18383069-18383091 AGAGCTCCTCAACTGCCCCAGGG + Intergenic
1085335119 11:75687645-75687667 AGAGCTGGTGCACTGTGCTGGGG + Intergenic
1085882647 11:80485881-80485903 TGAGCTCCTGCAAAGAGCCGTGG - Intergenic
1086405783 11:86497935-86497957 AGAGCTCCTGCCCTGGGCAGTGG + Intronic
1091780783 12:3213414-3213436 AGAGCTCCTGCCCAGAGCCCAGG - Intronic
1093294466 12:17370924-17370946 AGAGCTCCAGGACTGAGCCTTGG + Intergenic
1093528759 12:20136031-20136053 AGAACTGCTGCACTGTGCTGGGG + Intergenic
1094424752 12:30306106-30306128 AGAGCTCCTGGACTGCCTCCTGG - Intergenic
1097517018 12:60618417-60618439 AGAGCTGGTGCACTGTGCTGGGG - Intergenic
1099283485 12:80684212-80684234 AAACCTCCTGCACTTCACCGCGG - Intergenic
1101046025 12:100806827-100806849 AGAGCTCCTGGACAGCGCAGTGG - Intronic
1101950057 12:109167719-109167741 TGAGCTCCTGCTCTGTGCTGGGG + Intronic
1111628008 13:90813824-90813846 AGAGCTCAAGCACTGTGCTGAGG - Intergenic
1116312274 14:43342159-43342181 AGAGCTGGTGCACTGTGCTGGGG + Intergenic
1117452614 14:55865696-55865718 AGGGCAGCTGCACTGTGCCGGGG + Intergenic
1118516028 14:66529961-66529983 AGAGCTCAAGCACTGTGCTGGGG + Intronic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1122258694 14:100499750-100499772 AGAGCTCCTGTCCTGGGCTGTGG + Intronic
1122945607 14:105007294-105007316 TGAGCCTCTGCACTGCGCAGAGG - Intronic
1123939890 15:25211717-25211739 TGATCTCCTGCACTGAGCTGTGG + Intergenic
1123945717 15:25237911-25237933 TCAGCTCCTGCACTGAGCTGGGG + Intergenic
1132137998 15:99363149-99363171 AGAGCTGCTGCACTGCCCTCTGG + Exonic
1132257910 15:100393557-100393579 AGAGCTGCGGCACTGCTCAGTGG - Intergenic
1132648527 16:1010099-1010121 ATAGCTTCTGCACTGCTCGGGGG - Intergenic
1140669988 16:77268987-77269009 AGAGCTCCTGCAGTTTGCTGGGG + Intronic
1141230485 16:82162645-82162667 GGAGGTGCTGCACTGCCCCGAGG + Intronic
1142306931 16:89290968-89290990 AGAGCCCCTTCCCTGCGCCAGGG + Intronic
1142570722 17:872104-872126 AGAGTTCCTGCACTGAGTCCTGG + Intronic
1142757576 17:2025028-2025050 TGAGCTCCAGCCCCGCGCCGAGG + Exonic
1144022713 17:11251312-11251334 AGAGCTCTTTCACTGCCCTGAGG - Intronic
1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG + Intergenic
1146371256 17:32266523-32266545 ACAGCACCGCCACTGCGCCGCGG + Intronic
1147915362 17:43882355-43882377 GGAGCTCCTGCAGTGCGCGGGGG + Exonic
1152572515 17:81127017-81127039 GCAGCTCCTGCACTGAGCCGAGG - Intronic
1161114577 19:2489359-2489381 AGGGCTCGGGCACTGCGCCAGGG + Intergenic
1161807261 19:6451872-6451894 AGAGCTACTGCACTGCAGCCTGG - Intronic
1162850579 19:13428213-13428235 AGAGCTCTTGCCCTGCGCAGTGG - Intronic
1163433483 19:17282066-17282088 GGAGCTGCTGCGCTGCGGCGCGG + Exonic
1164551002 19:29212673-29212695 AGAGCTCGTGAACTCGGCCGAGG + Intronic
1164595600 19:29529155-29529177 AGTGCTCCTCCCCTGCGCCCCGG - Intronic
1167211133 19:48134833-48134855 AGAGCACCTGCTCTGGGCCAGGG - Intronic
1167998367 19:53425237-53425259 AGAGCTGCTGCAGTGCGGTGTGG - Intronic
925752767 2:7104695-7104717 AGAGCTCAAGCACTGTGCTGGGG + Intergenic
927539114 2:23891537-23891559 AGAGCCACTGCACTCCACCGTGG - Intronic
929053046 2:37854099-37854121 AGAGCTCCAGGACTGAGCCTGGG + Intergenic
933021663 2:77202035-77202057 AGAGCACCTGCACAATGCCGGGG - Intronic
938256304 2:129862270-129862292 CGAGCTCCTGATCTGCGCCACGG + Intergenic
939985876 2:148829532-148829554 TGAGCTCCTGCCCTGAGCCCTGG - Intergenic
941136362 2:161722699-161722721 AGAGCTGGTGCACTGCTCTGGGG + Intronic
943950001 2:194121339-194121361 ACAGCTCCTGCAGTGTGCTGCGG - Intergenic
946334879 2:219029903-219029925 AGAGCTCCTTCCCTGCTCCTAGG - Intronic
946397619 2:219451281-219451303 TGAGCTCCAGCACTGGGCCAAGG + Intronic
1169460253 20:5788466-5788488 AGAGCTGCTGCTCTGAGCCTAGG + Intronic
1170167837 20:13380590-13380612 AGAGCTCAAGCACTGTGCTGGGG + Intergenic
1170437158 20:16342025-16342047 AGAGCTCCTGCTCAGCCCCCAGG + Intronic
1170694713 20:18647867-18647889 AGAACTGCTGCACTGGGCCAGGG + Intronic
1178358060 21:31924728-31924750 AGAGCACCTGCACCGGGCCGGGG + Exonic
1178416913 21:32412138-32412160 AGAGCTTGGGCACGGCGCCGGGG + Intronic
1178778136 21:35572147-35572169 AGAGATCTTGCACTGTGCCACGG + Intronic
1179154480 21:38838231-38838253 ACAGCTCCAGCAATGCGCCGTGG - Intergenic
1180581840 22:16845557-16845579 AGAGCTGCTGCCCTGTGCCCAGG - Intergenic
1181658548 22:24321934-24321956 AGAGATCCTCCACTGAGCCAGGG - Exonic
1183381181 22:37491320-37491342 AGAGCACCTGCTCTGAGCCACGG + Exonic
1185032959 22:48454615-48454637 TGAGCTCCTGCCCTGCTCTGGGG - Intergenic
950521537 3:13500650-13500672 GGAGCTCCTGGACTGAGCCTGGG + Intronic
955291029 3:57692734-57692756 GGCGCTCCTCCCCTGCGCCGGGG - Intronic
956383007 3:68685968-68685990 AGAGCTCAAGCACTGTGCTGGGG + Intergenic
959579425 3:107968592-107968614 AGAGCTCCTGTTCTGCCCCCAGG + Intergenic
960056922 3:113282588-113282610 AGAGCTCCTGCCCCGTGCAGGGG + Intronic
961949373 3:130732087-130732109 AGAGCTCCTGCTCTACACCTTGG - Intronic
962859784 3:139389274-139389296 AGAGCTCCTGCAGTCTGCAGCGG - Intronic
963201871 3:142594413-142594435 TGAGCTACTGCACTGGGCCCTGG + Intergenic
966151944 3:176875244-176875266 AGAGTTGCTGCACTGTGCTGGGG + Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
968945712 4:3662611-3662633 ACAGCCCCTGCACTGCGTCCCGG + Intergenic
969293829 4:6257505-6257527 AGAGCGCCTGCATTGAGCAGGGG + Intergenic
970637106 4:18021671-18021693 AGGGCTCCGGCACTGAGCGGCGG + Exonic
985524489 5:395095-395117 AAAGCCCCTGCCCTGGGCCGTGG + Intronic
985764816 5:1771689-1771711 AGAGCTGCCGCACAGCGCCGAGG + Intergenic
986291370 5:6401843-6401865 AGATCTCTTGCTCTCCGCCGTGG - Intergenic
991242385 5:64474681-64474703 AGAGCTCGAGCACTGTGCTGGGG - Intergenic
993018403 5:82563074-82563096 AGAGCTGCTGGACTGTGCCGAGG - Intergenic
995712689 5:115051103-115051125 TGAGCTCCTGCCCTGTGCCAGGG + Intergenic
1001687106 5:173601969-173601991 AGAGCTCCTGCAGGGAGCCCTGG + Intergenic
1004495734 6:16160931-16160953 GGGGCTCCTGCTCTGCGCCATGG + Intergenic
1014818134 6:125957160-125957182 CGAACTCCTGCACTGCGAGGTGG + Exonic
1015488634 6:133800280-133800302 AGAGCTGTTGCACTGTGCTGGGG + Intergenic
1016590110 6:145735154-145735176 GGAGCTCCCGCTCTGCGCCGGGG + Intronic
1017536218 6:155350044-155350066 AGAGCTGCTGCGCTGTGCTGGGG + Intergenic
1023514302 7:40985353-40985375 CTATCTCCTGCACTGCGCTGAGG - Intergenic
1024165103 7:46722971-46722993 AGAGCTGCTGTACTGTGCTGGGG - Intronic
1026152490 7:67800152-67800174 AGAGCTCCTCCTCTGCTCCCAGG - Intergenic
1026603862 7:71799349-71799371 AGAGCTCCAGCTCTGCACCCAGG - Intronic
1026898704 7:74025654-74025676 GGAGCTCCTGCAATGAGCAGAGG + Intergenic
1030375273 7:108746286-108746308 AGAGCTGCTGGACTGTGCTGGGG + Intergenic
1032775609 7:135109764-135109786 AGAGCTGCTGTGCTGCGCCAGGG + Intronic
1038475136 8:27860704-27860726 TGAGCTGCTGCACTCAGCCGAGG + Intergenic
1039880379 8:41621852-41621874 AGAGCTGCTGCACTGGGCTTTGG + Exonic
1040462468 8:47662091-47662113 AGAGCGCCTGCACTGGCCTGAGG - Intronic
1041012620 8:53559245-53559267 AGGGCGGCTGCACTGCGCTGGGG - Intergenic
1047000839 8:120570753-120570775 AGAGCTCGTGCACTGCTGCATGG - Intronic
1048847319 8:138613617-138613639 AGAGCTCCAGCAGTGCCCCGTGG + Intronic
1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG + Intergenic
1058508797 9:105694364-105694386 CCAGGTCCTGCACTGCGCCCAGG + Intergenic
1060204374 9:121674035-121674057 TGGGGTCCTGCACTGCCCCGTGG - Intronic
1061700193 9:132410055-132410077 GGGGCTCCTGCATTGCTCCGGGG + Intronic
1061972444 9:134052218-134052240 AGAGCTGCTGCAAAGCGCCCAGG + Intronic
1061975927 9:134068046-134068068 AGGGCTCATGCGCTGCGCCGCGG + Intronic
1191094289 X:56658668-56658690 AGAGCTTGTGCACTGTGCTGGGG + Intergenic
1191208152 X:57855611-57855633 AGAGCTCGAGCACTGTGCTGGGG - Intergenic
1191785058 X:64908211-64908233 AGAGCTCAAGCACTGTTCCGGGG - Intergenic
1191877313 X:65809781-65809803 AGAGCTGCTGCACTGTGCTGGGG - Intergenic
1194468941 X:94268567-94268589 TGAGCCACTGCACTGGGCCGAGG - Intergenic
1195533349 X:105982542-105982564 ATAGCTCCTGCACTGGTCAGTGG - Intergenic
1198648707 X:138837725-138837747 AGAGCCGCTGCACTGTGCTGGGG + Intronic
1200365353 X:155657114-155657136 AGAGCTCGAGCACTGTGCTGGGG + Intronic