ID: 1064128408

View in Genome Browser
Species Human (GRCh38)
Location 10:12685388-12685410
Sequence ATATATCTGGTGTTTCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064128408_1064128410 2 Left 1064128408 10:12685388-12685410 CCATTTGGAAACACCAGATATAT 0: 1
1: 0
2: 5
3: 24
4: 245
Right 1064128410 10:12685413-12685435 GAGTTTCTGCATCTTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064128408 Original CRISPR ATATATCTGGTGTTTCCAAA TGG (reversed) Intronic
900887459 1:5425200-5425222 ATACATCTAGTGTTTAAAAACGG + Intergenic
903249694 1:22043697-22043719 GTATCTCTGTTGTTGCCAAAAGG - Intergenic
903908770 1:26706628-26706650 ATATATCTGTTTCTTCCAAAAGG - Intronic
904443860 1:30551694-30551716 ATAGGTCTGGGATTTCCAAAGGG - Intergenic
904958389 1:34308536-34308558 ATATATCTGTTGGTTCCATTTGG - Intergenic
905636688 1:39558664-39558686 ATATCTGTGATGTTTCCAAAAGG + Intergenic
905662800 1:39740215-39740237 ATATCTGTGATGTCTCCAAAAGG - Exonic
906457509 1:46009792-46009814 ATATATGTGGTGTGTCTACATGG - Intronic
906547693 1:46632895-46632917 ATGTATTTGGAGTTTGCAAAGGG + Exonic
908411708 1:63872531-63872553 ATATAGTTGGTGTTCCCTAAAGG + Intronic
908946449 1:69503695-69503717 ATATATCAGGTGATAACAAAGGG + Intergenic
911271696 1:95809499-95809521 ATAAAACTGGTTTTTCCACAGGG + Intergenic
911417847 1:97598004-97598026 ATATATATGGTTTATCCATATGG - Intronic
912338456 1:108886645-108886667 ATATATAAGGTGTAGCCAAAGGG - Intronic
917423895 1:174893234-174893256 ATTTATATCGTGATTCCAAATGG - Intronic
918489273 1:185063176-185063198 AAACATCTGGCATTTCCAAATGG - Intronic
919526383 1:198657672-198657694 AGATTTCTGGTATTTCCATATGG - Intronic
920136779 1:203776007-203776029 ATAGTTCTTGTGTTTGCAAATGG - Exonic
920297315 1:204966974-204966996 ATGTAACTGGTGCTTCCTAAAGG - Intronic
920922084 1:210306307-210306329 TCATTTCTGGTGTGTCCAAAAGG + Intergenic
921570522 1:216772871-216772893 TGATATTTGGTGTTTCCAAAAGG + Intronic
921572171 1:216793058-216793080 ATAAATATGGATTTTCCAAAAGG - Intronic
921802847 1:219420962-219420984 ATATATCAGTTATTTCTAAATGG + Intergenic
923460130 1:234202486-234202508 TTAGATATGGTGTTTACAAATGG - Intronic
924646389 1:245881299-245881321 ATATATCCTGTCTTTCCAACGGG + Intronic
924812537 1:247416040-247416062 ACATAGCTGGATTTTCCAAATGG - Intergenic
924928377 1:248705495-248705517 ATATATCTGGTCTTACCAGCTGG - Intergenic
1064128408 10:12685388-12685410 ATATATCTGGTGTTTCCAAATGG - Intronic
1065379856 10:25078950-25078972 ATATATATACTTTTTCCAAAAGG + Intergenic
1066181542 10:32966556-32966578 ATATATATGGTGTGGTCAAATGG + Intronic
1067072034 10:43139578-43139600 ATATATCTGGTGGTTCCACAGGG - Intronic
1067208670 10:44240822-44240844 ATTTATCTGATTTTTCTAAAAGG - Intergenic
1069054814 10:63833566-63833588 ACATATCTTTTGATTCCAAATGG - Intergenic
1070376497 10:75836471-75836493 ATATTTCTGTTGTTGCTAAAGGG + Intronic
1074228478 10:111511133-111511155 AAATGTCTTCTGTTTCCAAAGGG + Intergenic
1074255936 10:111802560-111802582 ACATATCTCATGTTTGCAAAAGG + Intergenic
1077238425 11:1496773-1496795 ATGTATCTGATGTTTAGAAAAGG + Intronic
1077720581 11:4624743-4624765 GTGTATATGGTGTTTTCAAAGGG + Intergenic
1077859307 11:6160720-6160742 ATATTTCTGGTGACTACAAAGGG - Intergenic
1078941413 11:16010581-16010603 TTATACCTGGGGTTTCTAAAGGG - Intronic
1079048403 11:17130081-17130103 ATTCATCTAGTTTTTCCAAAAGG - Intronic
1080185973 11:29486842-29486864 AAAAATGTGGTGTTTCCAATTGG - Intergenic
1081196705 11:40169927-40169949 CTTTATCTTGTGTTTGCAAAAGG - Intronic
1081244262 11:40745251-40745273 AACTATCTGTTCTTTCCAAAGGG + Intronic
1081858451 11:46318329-46318351 AGATATCTACTGTTTCCAAGGGG + Intronic
1082177856 11:49082451-49082473 AGAAATCTGGTGTCTCCAAGAGG + Intergenic
1084909339 11:72375104-72375126 AAATATCTGGAGATTCCTAAAGG - Intronic
1086676705 11:89617104-89617126 ATTTATAAGGTGTTTCCACAAGG + Intergenic
1086720748 11:90118223-90118245 ATACATTTGTGGTTTCCAAAAGG - Intergenic
1088030411 11:105241701-105241723 ATAAAACAGTTGTTTCCAAAAGG + Intergenic
1088300560 11:108353813-108353835 ATATCTCTGGTGAGTCTAAAAGG - Exonic
1088550958 11:111011875-111011897 ATAAATGTGGTGTCTCCACAGGG + Intergenic
1088934375 11:114384222-114384244 ACATGTCTGGTATATCCAAAAGG + Intergenic
1089067840 11:115675407-115675429 ATATATCTGCTCTTTCAGAATGG - Intergenic
1092974615 12:13732294-13732316 ATAAATGTGGTGTTTACAAGTGG - Intronic
1093091996 12:14932298-14932320 ATATCTCTGGAATCTCCAAATGG - Intronic
1093246502 12:16744332-16744354 ATAAAACTGGTGTTTCAAATAGG + Intergenic
1093950064 12:25155541-25155563 ATATAACTGATATCTCCAAAAGG + Intronic
1094112366 12:26875223-26875245 ATGTATCTGCAGTTCCCAAATGG - Intergenic
1094300341 12:28957641-28957663 ATCTATGTGGTTTTTCCAGAAGG + Intergenic
1095590026 12:43892654-43892676 ATATCTCTGGAATTTCCAGAAGG - Intronic
1096834884 12:54343527-54343549 ACATATATGATGTTTCCTAATGG - Intronic
1097793623 12:63840879-63840901 CTAAATCTGCTGTTTCCTAAGGG - Intergenic
1098413535 12:70206981-70207003 ATACATCTGATGTTTCTAATTGG + Intergenic
1099786471 12:87270322-87270344 ATATATCTTCTGTTGCCAATGGG + Intergenic
1100566516 12:95799778-95799800 GGATATCTGGAGTTTACAAATGG - Intergenic
1101577310 12:106009649-106009671 ATTTATCTGATGTTTCCTTATGG - Intergenic
1104234872 12:126924209-126924231 TTATATCTAATGTTTCCCAAAGG + Intergenic
1105210070 13:18252497-18252519 AAAAACCTGGTGATTCCAAAGGG - Intergenic
1106341936 13:28838286-28838308 CTATATCTGGGGTACCCAAATGG + Intronic
1106390015 13:29326081-29326103 ATAAATCTGGAATTTCTAAAGGG + Intronic
1108485941 13:50925011-50925033 GTATAACTGGAGTTTCCAAAAGG - Intronic
1108959373 13:56204539-56204561 GTGTATCTGATGTCTCCAAATGG + Intergenic
1110041405 13:70764200-70764222 AAATAACTTGTGTTTTCAAAAGG + Intergenic
1111234509 13:85391098-85391120 ATATATTTAGTGTTTGCAGAAGG + Intergenic
1111342436 13:86904971-86904993 AAATATTTGGTGTTACAAAATGG - Intergenic
1113732596 13:112652590-112652612 AGATATCTGGGGTTCACAAAGGG - Intronic
1116601313 14:46927729-46927751 ATATATTTGCTGTTACTAAATGG - Intronic
1116767923 14:49094537-49094559 ATATCTCTGATGTCACCAAAAGG + Intergenic
1117915980 14:60678256-60678278 ATATAATTGCTCTTTCCAAATGG - Intergenic
1119288256 14:73473902-73473924 ATATAACTGGGGTCTCAAAAAGG + Intergenic
1120031436 14:79645837-79645859 ATAAATCTGTTGTTGCCAAAAGG - Intronic
1121902918 14:97710579-97710601 ATATTTCTGTTGTTTCCAAATGG + Intergenic
1121965819 14:98304588-98304610 ACATATCTAGTGGTTGCAAATGG - Intergenic
1124158040 15:27245268-27245290 AAAAATCTGGTGTTTCCAAACGG - Intronic
1125381919 15:39095265-39095287 ATATTTCTGGTGATACAAAATGG + Intergenic
1125978717 15:43979581-43979603 ATGTATGTGTTATTTCCAAATGG - Intronic
1130119396 15:81034267-81034289 ATATACATGGTGATTCCAGAGGG + Intronic
1130678530 15:85975807-85975829 ATCTATTTGATGTTTCTAAATGG + Intergenic
1133557768 16:6922026-6922048 ATATAACTGCTGTTACCAACTGG + Intronic
1133681554 16:8124779-8124801 ATATATGTGGTGGTTGAAAATGG - Intergenic
1135686787 16:24504161-24504183 ATATATCAGCTGGTTCCTAATGG + Intergenic
1138890306 16:61135109-61135131 ATATATATGGTGTATACATATGG - Intergenic
1138890309 16:61135140-61135162 ATATATATGGTGTATACATATGG - Intergenic
1141766338 16:86062186-86062208 ATAAATCAGGTCTTTCTAAATGG + Intergenic
1145186310 17:20797422-20797444 ATATCTCTAGTGTCACCAAAGGG + Intergenic
1148065990 17:44870393-44870415 ATATATCAGTTATTTCCAGATGG - Intronic
1149056022 17:52366890-52366912 ATATAACTGGTATTCTCAAAGGG - Intergenic
1149303250 17:55324902-55324924 ATCTTTGTGGTGTTGCCAAAAGG - Exonic
1152943850 17:83187552-83187574 ACATATCTGGTGTATACACAGGG + Intergenic
1152970892 18:159491-159513 ATATGTGTGGTGTCTCCAATTGG + Intronic
1153222330 18:2872789-2872811 ATATAACTGTTGTTTGAAAAAGG + Intronic
1154378354 18:13827440-13827462 CTCAATCTGGGGTTTCCAAAAGG + Intergenic
1155609413 18:27648053-27648075 ATAATTCTGGTGTATCCACAGGG + Intergenic
1156812588 18:41270789-41270811 ATGTATGTGTTATTTCCAAAAGG - Intergenic
1158842542 18:61403634-61403656 ATATAGCTGGTGCTTCCACAGGG - Intronic
1158988373 18:62842703-62842725 ATATATCTGGTTTTTAAAATTGG - Intronic
1162865295 19:13541412-13541434 ATATATATGGTTTTTCCAAAGGG - Intronic
1163991031 19:20999625-20999647 ACATATATGTTGTTTACAAATGG - Intergenic
1164224712 19:23233148-23233170 ATAAAACTGATGTTTCCATATGG - Intronic
1165522262 19:36323911-36323933 CTATATGTAGTGTTTCCATATGG - Intergenic
1167712680 19:51122090-51122112 ATATATCTGGGGTCTTCCAAGGG - Intergenic
1167927501 19:52833485-52833507 AAATACCTGGTGTTTCAGAAAGG + Intronic
924974876 2:163309-163331 ATAAATCTGCTATTTCCAATTGG + Intergenic
925547383 2:5031834-5031856 ACATATTTGGTGTTATCAAATGG - Intergenic
925734240 2:6946892-6946914 ACATATCTGGTGGTTCCCAAAGG + Intronic
926490684 2:13522659-13522681 ATCCAGCTGGTGTTTCTAAAAGG + Intergenic
928831997 2:35498431-35498453 AGATCTCTGGTATTTCCAATTGG + Intergenic
929286142 2:40137333-40137355 ATACATCTCTTGTTTTCAAAAGG - Intronic
930742760 2:54849291-54849313 ATCTATCAGATATTTCCAAATGG - Intronic
931007085 2:57863312-57863334 ATGTATCTGGTGTGTGGAAAAGG + Intergenic
931300003 2:60970288-60970310 ATATATCTGCATTTTCAAAAGGG - Intronic
931408003 2:61999851-61999873 TGATATTTGATGTTTCCAAAGGG + Intronic
935420853 2:102867303-102867325 ATATAATTGGTGTTTTTAAAGGG + Intergenic
935613375 2:105049727-105049749 ATATATCTGAGGTTTCAAAATGG + Intronic
937086521 2:119175375-119175397 ACATGGCTGGTGTCTCCAAACGG - Intergenic
938592533 2:132753364-132753386 ATGAATCTGGTGTTTCAAAATGG + Intronic
938911927 2:135893731-135893753 ATATACCTGGAGTTTCTCAAAGG - Intergenic
941300771 2:163798380-163798402 ATATAACTGGAGTCACCAAAAGG - Intergenic
941502866 2:166302108-166302130 ATATATGTGCTGTTGCCAAAAGG - Intronic
941727470 2:168878468-168878490 ATATATTTGGCATTTCCAAAAGG + Intronic
941939974 2:171024729-171024751 ATAGATCTGGGCTTTCAAAAAGG + Intronic
942551683 2:177126387-177126409 ATATATCTTGTATTTCGAATGGG + Intergenic
944160521 2:196654694-196654716 AGATATATGGTTTTTCCAAGAGG - Intronic
945387833 2:209224551-209224573 ATAAATTTAGTGTTTTCAAAGGG + Intergenic
945507671 2:210661444-210661466 AAATTTCTGATGTTTTCAAAAGG + Intronic
945957383 2:216098949-216098971 ATATATGTGGTGTGTGCATACGG + Intronic
946783787 2:223221019-223221041 GTATATCTTCTATTTCCAAAAGG + Intergenic
1168871903 20:1136220-1136242 ATATATCTTATTTTACCAAAGGG + Intronic
1172432117 20:34900723-34900745 AAATCTGTGGTGTTTTCAAAAGG + Intronic
1177201621 21:17963175-17963197 GAATCTCTGGTGTATCCAAATGG - Intronic
1177291303 21:19116545-19116567 TTATATATGGTGTTACAAAAGGG + Intergenic
1177792687 21:25737029-25737051 ATTTATCTGTAGTTTCAAAAGGG + Intronic
1178234946 21:30830703-30830725 ATATAACTGGTATTTCATAATGG - Intergenic
1179283980 21:39960379-39960401 ATATATTTGGTGTCCCAAAAAGG - Intergenic
1179470349 21:41606032-41606054 ACATCTCTGGTTTTTGCAAATGG + Intergenic
1180541145 22:16448711-16448733 ATATATTTGGTCTTTGCACATGG - Intergenic
1184358589 22:43999289-43999311 ATTTATCTGGTCTTTAAAAAGGG - Exonic
1185113625 22:48918825-48918847 ATAAACCTGGTGTTTACAAAAGG + Intergenic
950911410 3:16598086-16598108 ATCGAACTGGTGTGTCCAAAGGG - Exonic
951152062 3:19302288-19302310 GTATTTCTGGAATTTCCAAAGGG - Intronic
951154011 3:19326948-19326970 ATATATCTGGTGTCTTAACAGGG + Intronic
951322345 3:21260660-21260682 ATATATCTGGTTTTTTCTAAGGG - Intergenic
952101608 3:30019525-30019547 ATCTATCTGGTATCTCAAAAAGG - Intergenic
952754376 3:36853320-36853342 TTCTATCTGGTGTTTGAAAAGGG - Intronic
954046464 3:47935591-47935613 GTATATCAGGTTTCTCCAAAAGG - Intronic
955273345 3:57523711-57523733 ATATAACTGATGTTTTTAAAAGG - Intronic
955780685 3:62481239-62481261 ATATTTCTGGTGTCAGCAAATGG - Intronic
956619449 3:71206409-71206431 ATATATTCAGTGTTTCCAATGGG - Intronic
956882274 3:73522600-73522622 ATTTATCAGGTGCTTCCAAGAGG - Intronic
956990806 3:74761963-74761985 ATATATCTGGACTTTCTAATTGG - Intergenic
957283145 3:78180160-78180182 ATAAATTTTGTATTTCCAAAAGG + Intergenic
957352333 3:79041650-79041672 ACAGATCTGCTTTTTCCAAAAGG + Intronic
958126622 3:89364603-89364625 ATATATCTGGTTTTTTAACAAGG - Intronic
958130319 3:89411023-89411045 ATATAATTGATGTTTCCTAATGG - Intronic
958418020 3:93899628-93899650 ATATTTTTGGTGATTGCAAAAGG + Intronic
959151449 3:102612830-102612852 ATAGATCTGGTTGCTCCAAAGGG - Intergenic
959187657 3:103066704-103066726 AAATATATGATGTTCCCAAATGG + Intergenic
962113693 3:132478099-132478121 ATATATCTGGTATCTGTAAAAGG - Exonic
962143392 3:132814244-132814266 AGATACCTGCTGTTTCCGAAGGG - Intergenic
963186905 3:142428791-142428813 GTATATCTGGGGTTTCCAAAAGG + Intronic
963391648 3:144672630-144672652 TTATTTCTGGTGTTGGCAAAGGG - Intergenic
964331264 3:155605879-155605901 ATACATGAGGTGTCTCCAAAGGG - Intronic
964420035 3:156492467-156492489 GTATATATGGTGTCTCCATATGG - Intronic
968383693 4:117326-117348 ATTTCTCTGGAGTCTCCAAATGG + Intergenic
968962158 4:3751130-3751152 CTGTCTCTGATGTTTCCAAAGGG - Intergenic
969063815 4:4461194-4461216 ATATATATAATGTTTCCTAAAGG - Intronic
971606048 4:28659525-28659547 ATATGTCTGTAATTTCCAAACGG - Intergenic
972422601 4:38903548-38903570 ATATATATGCATTTTCCAAAAGG - Intronic
974004485 4:56542580-56542602 AAATAAATGGTGTTTCTAAAAGG - Intronic
975791937 4:77962404-77962426 AAAAACCTGGTGTTTCCCAAAGG + Intergenic
976129176 4:81866644-81866666 AAATATTTGGAGTTTCCATAAGG + Intronic
976528612 4:86122814-86122836 ATAAATCAGGAGTTTACAAATGG - Intronic
977194145 4:94038453-94038475 AGATATCTGCTGTTTCCAAGGGG + Intergenic
977345351 4:95810476-95810498 ATATATTTGGTGTTTAGACATGG + Intergenic
977861275 4:101963367-101963389 ATAAATATCTTGTTTCCAAATGG - Intronic
978637090 4:110822482-110822504 ATATGTCTATTGTCTCCAAATGG - Intergenic
979064570 4:116112963-116112985 ATGTATCAGATGTTCCCAAATGG - Intergenic
979807233 4:124989250-124989272 ACATATCTGGTATTTTCAAAGGG + Intergenic
980011068 4:127595208-127595230 ATACATCTAGTGTAGCCAAAGGG + Intergenic
980652478 4:135736802-135736824 ATATACCTGATGTTTCTAAATGG + Intergenic
981340621 4:143617614-143617636 CTATATCTGGTGCTTTCAAGAGG - Intronic
981807914 4:148738445-148738467 GTCTATATGGTCTTTCCAAAGGG - Intergenic
982486082 4:155967509-155967531 AAGGATCTGGAGTTTCCAAATGG + Intergenic
983790333 4:171789213-171789235 ATATTTCTGGTCTTTTCACAAGG + Intergenic
984466957 4:180111667-180111689 ATATCTTGGGTGTTTCCACATGG + Intergenic
985296379 4:188441440-188441462 ATATATATGGTGTATCTATATGG + Intergenic
985910862 5:2880577-2880599 AAATATCTGCTGTTTGCAAGAGG + Intergenic
985981500 5:3470381-3470403 ATATATCTAGCCTTTCCAAATGG + Intergenic
985990785 5:3559161-3559183 GTATATCTAATGTTTCAAAATGG - Intergenic
987733806 5:21812229-21812251 AAATAACTGGTGTTTAAAAAAGG + Intronic
987775200 5:22356588-22356610 ATATATCTGATGTATACATATGG + Intronic
988677693 5:33450246-33450268 ATTCATATGGTGATTCCAAATGG - Intronic
989712072 5:44411257-44411279 ATAGATCTGGTGTTTAGTAAGGG - Intergenic
989830575 5:45913192-45913214 ACAAAACTAGTGTTTCCAAATGG + Intergenic
990057674 5:51604488-51604510 ACAAATATGGTCTTTCCAAATGG + Intergenic
991145040 5:63291526-63291548 ATGGATCTGATTTTTCCAAATGG + Intergenic
992367868 5:76111805-76111827 ATTTTTCTGGTGTTGCCAACAGG - Intronic
993208384 5:84916407-84916429 ATGTTTCTGGTGTTTTCAATAGG + Intergenic
993787040 5:92154270-92154292 ATATATATGAAATTTCCAAAAGG - Intergenic
994734055 5:103530407-103530429 ATTTATTTGCTGTTTTCAAAGGG - Intergenic
995990463 5:118232132-118232154 ACATTTCTGGGGTTTCCAATGGG + Intergenic
1000919193 5:167118503-167118525 ATATAACTGAGCTTTCCAAAAGG - Intergenic
1002407635 5:179048240-179048262 ATAAATCAGGTGTGACCAAAAGG + Intergenic
1004970299 6:20902590-20902612 CTATATCTGGAGTTTGAAAAAGG + Intronic
1005929153 6:30468322-30468344 ATATATCTCATTTTTCAAAAAGG - Intergenic
1008192236 6:48474614-48474636 ATAAATGTGGTGTTTCTATAGGG - Intergenic
1008239768 6:49095794-49095816 ACCTATCTAGTGTTTCAAAATGG + Intergenic
1010183993 6:73121760-73121782 ATGGATCTGGTGCTTCCCAATGG - Intronic
1010882465 6:81195895-81195917 ATATATATGGTGTTTTTAAATGG + Intergenic
1011050724 6:83146385-83146407 TTTTATCTTGTGTTTCCAAAGGG + Intronic
1012717984 6:102701337-102701359 CTAGATCTGGGCTTTCCAAAGGG + Intergenic
1013413118 6:109899419-109899441 ATGTGTCTGGTGTTTCTAGATGG + Intergenic
1013600134 6:111696139-111696161 ACATAACTGGTGGTTCCTAATGG + Intronic
1018239556 6:161759785-161759807 ATATATCTGGTGTTTCAAGTGGG + Intronic
1021102012 7:16594968-16594990 CTTTATCTGATGATTCCAAATGG - Intergenic
1021209556 7:17830397-17830419 ATAGTGCTGGTGTTTCCTAATGG - Intronic
1022457221 7:30568115-30568137 ATATATCAGGTGGTCCAAAAAGG - Intergenic
1023541233 7:41268666-41268688 ATATATCAAGTGTTTTTAAATGG - Intergenic
1024444856 7:49465407-49465429 ACATAAGTGGTGTTTGCAAAGGG - Intergenic
1024798939 7:53053337-53053359 AAATATATAGTGTTTCTAAAAGG - Intergenic
1027304614 7:76880169-76880191 CTATATCAAGTGTTTCTAAATGG - Intergenic
1027701131 7:81471418-81471440 AGACATCTGGTATTACCAAATGG + Intergenic
1028066049 7:86385968-86385990 ACATATATGGTGCTTCCAATGGG + Intergenic
1028193840 7:87881838-87881860 TTATCTCTGTTGATTCCAAACGG - Intronic
1028363562 7:89998261-89998283 ATGTCTCTGATGTTCCCAAAAGG - Intergenic
1033969098 7:147016061-147016083 AAATTTCTGGTGTTCCCAAAGGG - Intronic
1035895691 8:3398006-3398028 AAATATCGGGTATTTCCAAATGG + Intronic
1035915616 8:3618644-3618666 ATTTCTTTGGTGTTTCCATAGGG - Intronic
1036651148 8:10644799-10644821 ATATTTCTGGTGCTTCCTATGGG + Intronic
1037163645 8:15800778-15800800 ATATTTCTTGTGTTTGAAAAAGG - Intergenic
1041813102 8:61934189-61934211 ATATATCTAGTTTTTAAAAAAGG + Intergenic
1041989719 8:63972076-63972098 ACATTTCTGGTGTTACAAAAGGG + Intergenic
1043190162 8:77211100-77211122 ATATATATGATATATCCAAATGG + Intergenic
1045413070 8:101938842-101938864 ATCTGTCTGGTGTTGTCAAAGGG + Intronic
1046371747 8:113318065-113318087 ATATATCTTTTGTGTACAAAGGG + Intronic
1046670300 8:117049663-117049685 ATTTATTTGGTGTTTTCAGAAGG - Intronic
1051497503 9:17740363-17740385 ATAGATCTTGTTTTTCCAGATGG - Intronic
1051543366 9:18246377-18246399 AATCATCTTGTGTTTCCAAATGG - Intergenic
1052029096 9:23608486-23608508 ATGTATCTGGAGTTTGCAAGTGG - Intergenic
1052206684 9:25849676-25849698 AAAAGTCTGGTGGTTCCAAAAGG - Intergenic
1055742060 9:79400771-79400793 ATATATCTGGATTCTCCAAGAGG - Intergenic
1057110677 9:92467767-92467789 ATATATCTGGAATTTCCAGAGGG - Intronic
1058504900 9:105656975-105656997 ATATATATGGTGATTTTAAAGGG + Intergenic
1058832026 9:108826347-108826369 ATATATCTGGTCTATCTAGAAGG + Intergenic
1187883820 X:23870380-23870402 GTATATCTGGTGTCTCCCCAAGG + Intronic
1188251527 X:27901551-27901573 CAATATCTTGTATTTCCAAAAGG + Intergenic
1188818123 X:34740062-34740084 ATACATTTGGTGTATCCTAAGGG + Intergenic
1193837697 X:86366138-86366160 ATCCATTTGGTGCTTCCAAATGG + Intronic
1195223325 X:102767433-102767455 ATCTATCTGCTGTCTCCTAAAGG - Intergenic
1196754576 X:119147033-119147055 ACATTTCTGGTGCTTTCAAATGG + Intronic
1197334611 X:125197365-125197387 AAATATATGGTGATTTCAAAAGG + Intergenic
1197610009 X:128627694-128627716 ACAATTCTGATGTTTCCAAAGGG - Intergenic
1197855409 X:130909134-130909156 ATAAATCTGATTTCTCCAAATGG - Intergenic
1198071313 X:133151302-133151324 ATGTATAGAGTGTTTCCAAAGGG - Intergenic
1199285394 X:146049436-146049458 ATAGTTCTGGAGATTCCAAATGG - Intergenic
1200422651 Y:2988213-2988235 ATATATCTGGTATGTCCAATTGG + Intergenic
1201391796 Y:13505455-13505477 ATATATCTGCTGTTTTCAGCAGG + Intergenic
1202279754 Y:23169997-23170019 ATCGAACTGGTGTGTCCAAAGGG - Exonic
1202280483 Y:23180837-23180859 ATCGAACTGGTGTGTCCAAAGGG - Exonic
1202281212 Y:23191685-23191707 ATCGAACTGGTGTGTCCAAAGGG - Exonic
1202284679 Y:23226835-23226857 ATCGAACTGGTGTGTCCAAAGGG + Exonic
1202432884 Y:24806068-24806090 ATCGAACTGGTGTGTCCAAAGGG - Exonic
1202436353 Y:24841222-24841244 ATCGAACTGGTGTGTCCAAAGGG + Exonic
1202437081 Y:24852070-24852092 ATCGAACTGGTGTGTCCAAAGGG + Intronic