ID: 1064128410

View in Genome Browser
Species Human (GRCh38)
Location 10:12685413-12685435
Sequence GAGTTTCTGCATCTTTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064128406_1064128410 28 Left 1064128406 10:12685362-12685384 CCTTTAGTTGTAGATAAGTGTTA 0: 1
1: 0
2: 0
3: 5
4: 140
Right 1064128410 10:12685413-12685435 GAGTTTCTGCATCTTTTACAAGG No data
1064128408_1064128410 2 Left 1064128408 10:12685388-12685410 CCATTTGGAAACACCAGATATAT 0: 1
1: 0
2: 5
3: 24
4: 245
Right 1064128410 10:12685413-12685435 GAGTTTCTGCATCTTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064128410 Original CRISPR GAGTTTCTGCATCTTTTACA AGG Intronic
No off target data available for this crispr