ID: 1064131559

View in Genome Browser
Species Human (GRCh38)
Location 10:12714200-12714222
Sequence GTGGGGGGTGACGGTGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1402
Summary {0: 1, 1: 0, 2: 27, 3: 143, 4: 1231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064131559 Original CRISPR GTGGGGGGTGACGGTGGGGT CGG (reversed) Intronic
900169072 1:1257532-1257554 GTGGTGGGTACAGGTGGGGTGGG - Intronic
900201037 1:1406698-1406720 GCAGGGGGTGACAGTGGGGGTGG + Intronic
900324232 1:2100147-2100169 TTTGGGGGTGGTGGTGGGGTCGG - Intronic
900350022 1:2229958-2229980 GCGGGCTGTGGCGGTGGGGTGGG + Intronic
900418646 1:2546242-2546264 GTGGGGGGTGAGGGGGGTGGGGG + Intergenic
900418651 1:2546251-2546273 GAGGGGGGTGGGGGTGGGGGTGG + Intergenic
900431376 1:2604638-2604660 GTGGTGGGTGCCGGGGTGGTGGG + Intronic
900503386 1:3017324-3017346 GTGGGGGGTGCTGGCGGAGTGGG + Intergenic
900760031 1:4464131-4464153 GTCCGGGCTGACAGTGGGGTTGG - Intergenic
900787479 1:4657715-4657737 GGTGGGGGTGGGGGTGGGGTGGG + Intronic
900833955 1:4985591-4985613 GTGGGGGTGGATGGTGGGGTGGG - Intergenic
900913806 1:5620429-5620451 GTGTGTGGTGGTGGTGGGGTGGG + Intergenic
900973607 1:6004927-6004949 CTGAGGGGTGAGGGTGGAGTGGG + Intronic
900973686 1:6005205-6005227 CTGAGGGGTGAGGGTGGAGTAGG + Intronic
900973886 1:6005925-6005947 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973895 1:6005964-6005986 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973904 1:6006003-6006025 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973917 1:6006043-6006065 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973926 1:6006082-6006104 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973939 1:6006122-6006144 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973952 1:6006162-6006184 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973961 1:6006201-6006223 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973970 1:6006240-6006262 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973983 1:6006280-6006302 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973992 1:6006319-6006341 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974020 1:6006399-6006421 TTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974029 1:6006438-6006460 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974086 1:6006621-6006643 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974120 1:6006740-6006762 CTGAGGGGTGAGGGTGGAGTAGG - Intronic
900979221 1:6036788-6036810 GTGGCAGCTGAGGGTGGGGTGGG + Intronic
901242543 1:7704013-7704035 GTGGGCGGGGACGGTGGCGGCGG - Intronic
901497139 1:9628789-9628811 GTGGGTGGTGAAGGAGGAGTGGG + Intergenic
901807536 1:11747950-11747972 GTGGGAGGTTTCGGTGGGGCAGG - Intronic
901878190 1:12179020-12179042 TTGGAGGGTGACGGTGGGAGAGG + Intronic
901930522 1:12594060-12594082 GTGCTGGGTGACCTTGGGGTGGG + Intronic
902100525 1:13983875-13983897 GTGTGGGTTGAAGGTGGGGGAGG + Intergenic
902273633 1:15324345-15324367 GTGGGGGGTCCCAGAGGGGTAGG - Intronic
902943892 1:19820049-19820071 GTGAGGGGTGGGGGTGGGGGTGG - Intergenic
903066787 1:20704150-20704172 GTGGGGGGTGTGGTGGGGGTGGG + Intronic
903283631 1:22263975-22263997 CTGGGTGGTGGTGGTGGGGTGGG + Intergenic
903668527 1:25022308-25022330 GCAGGGGGTGGGGGTGGGGTAGG - Intergenic
903907624 1:26697263-26697285 GGTGGGGGTGGCGGTGGGCTGGG - Exonic
904082236 1:27879588-27879610 GTGGGGTGTCAGGGTGGGGCAGG - Intronic
904209879 1:28879964-28879986 GTGGGTGGGTAAGGTGGGGTTGG - Intergenic
904463727 1:30695619-30695641 GGGGTGGGTGGGGGTGGGGTGGG - Intergenic
904499364 1:30905307-30905329 GGTGGGGGTGGGGGTGGGGTGGG - Intronic
904825054 1:33268912-33268934 GTGGAGGATGAGGGTGGAGTGGG + Intronic
904831148 1:33307531-33307553 AGTGGGGGTGAGGGTGGGGTGGG - Intronic
904831159 1:33307554-33307576 AGTGGGGGTGAGGGTGGGGTGGG - Intronic
904831170 1:33307577-33307599 GGTGGGGGTGAGGGTGGGGTGGG - Intronic
904831242 1:33307750-33307772 GGTGGGGGTGAAGGTTGGGTGGG - Intronic
904831263 1:33307799-33307821 GGGTGGGGTGAGGTTGGGGTGGG - Intronic
904831306 1:33307918-33307940 GGTGGGGGTGAGGGTTGGGTGGG - Intronic
904831337 1:33307994-33308016 GAGGTGGGTGAGGTTGGGGTGGG - Intronic
904944244 1:34187772-34187794 GTGGGGGGCGGCGGGGGGGGGGG - Intronic
905223606 1:36465728-36465750 GGGGGGAGTGACAGTGCGGTGGG - Intergenic
905258101 1:36698372-36698394 GGTGGGGGTGAGGGTGGGGTGGG + Intergenic
905393530 1:37653020-37653042 GTGGGGGGTGGGGGTGGGGTGGG - Intergenic
905412211 1:37778517-37778539 GGGGGAGGTGACAGTGGTGTAGG - Intergenic
905506734 1:38485741-38485763 TTAGGAGGTGAGGGTGGGGTGGG + Intergenic
905546570 1:38804559-38804581 GTGGGGGGCGACGGAGGGGCGGG + Intergenic
905548022 1:38815673-38815695 GTGGGGAGTGAGGGTTGGGGAGG - Intergenic
905576639 1:39049989-39050011 GATGGGGGTGAGGGTGGGGCTGG - Intergenic
905786475 1:40761916-40761938 ATGGGGGGTGGCGGGGGTGTGGG - Intronic
905826722 1:41031320-41031342 GTGTGTGGTGGCGGTGGGGGAGG - Intronic
906262826 1:44406680-44406702 TTGGGGGGCGGGGGTGGGGTGGG - Intronic
906281156 1:44554780-44554802 GTGGGTGGTGAAGGTGAGCTGGG - Intronic
906589815 1:47014359-47014381 ATTGGGGGTGAGGTTGGGGTAGG + Intergenic
906668849 1:47640502-47640524 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
906725720 1:48042668-48042690 GTGGGGGGTGACGGGGGAAGGGG + Intergenic
906936074 1:50214979-50215001 ATGGGGGATGGGGGTGGGGTTGG - Intergenic
906950689 1:50332927-50332949 GTGTGGGGTGACGGGGTGGCGGG - Intergenic
907091519 1:51729806-51729828 GTGGGGGGTGAAGGGGGTGAAGG + Intronic
907270170 1:53286486-53286508 GGGAGGGGTGAGGGTGGGGGAGG - Intronic
907573791 1:55507529-55507551 GTGGGCTGTGACGGTGGAGATGG - Intergenic
907697077 1:56742047-56742069 GTCGGGGGTGGCAGTGGGGCTGG + Intronic
907766870 1:57421891-57421913 ATGGGGGGTGGCGGGGGGGGGGG + Intronic
907850057 1:58247787-58247809 GTGGGAGGTGGGGGTGGGGTGGG - Intronic
907936162 1:59044088-59044110 ATGTGGGGTGAGGGTGGGGAAGG + Intergenic
908835205 1:68222898-68222920 GTGTGGGGTGGGGGTGGGGGTGG + Intronic
909663464 1:78108747-78108769 GTTGTGGGTGAATGTGGGGTAGG + Intronic
910083131 1:83365639-83365661 GGTGGGGGTGAGGGTGGGGAGGG + Intergenic
910977148 1:92918774-92918796 GTGGGGAGTGCGGGTGAGGTGGG + Intronic
911104741 1:94120897-94120919 GTGGGGTGGGGTGGTGGGGTAGG - Intronic
911218254 1:95218906-95218928 GTGGGGAGTGACGATGTTGTAGG + Intronic
911413441 1:97540330-97540352 GTGGGGGGTGGGGGTGGCGGCGG + Intronic
912472654 1:109916232-109916254 TTGAGGGGTGAAGGTGGGGATGG - Intronic
912483731 1:110007155-110007177 ATGGAGGGTGAGGGTGGGGGAGG - Intronic
912684365 1:111750235-111750257 GTGGGGGGTGGCTGTGCAGTGGG + Intronic
912891102 1:113531709-113531731 GCGGGGGGTGGGGGTCGGGTGGG + Intronic
913586289 1:120278391-120278413 GTGGGGGGAGAGGGTGGGGCTGG + Intergenic
913588474 1:120299678-120299700 TTGGGGGGTGAAGGAGGGATAGG - Intergenic
913619711 1:120598691-120598713 TTGGGGGGTGAAGGAGGGATAGG + Intergenic
913621897 1:120619978-120620000 GTGGGGGGAGAGGGTGGGGCTGG - Intergenic
913688701 1:121257958-121257980 GTGGGGTGGGGGGGTGGGGTAGG + Intronic
914355963 1:146884862-146884884 GTGGGGGATGACGGTGGCTTAGG - Intergenic
914530778 1:148522496-148522518 GTGGGGGGGGGGGGTGGGGGGGG + Intergenic
914568298 1:148890249-148890271 GTGGGGGGAGAGGGTGGGGCTGG + Intronic
914570491 1:148911550-148911572 TTGGGGGGTGAAGGAGGGATGGG - Intronic
914602339 1:149218719-149218741 TTGGGGGGTGAAGGAGGGATGGG + Intergenic
914604527 1:149240000-149240022 GTGGGGGGAGAGGGTGGGGCTGG - Intergenic
914733918 1:150398110-150398132 CTGCGGGGTGGGGGTGGGGTGGG - Intronic
914875975 1:151512903-151512925 GTGGGAGGTGATGGGGGTGTAGG + Intronic
914984058 1:152441450-152441472 TTGGGAGGTGGGGGTGGGGTGGG + Intergenic
915068267 1:153244340-153244362 GTGGTGGGTGATGGTGGTGGAGG + Intergenic
915068352 1:153244691-153244713 GTGGTGGGTGACGGTGGTAAAGG + Intergenic
915121449 1:153631949-153631971 GGTGGGGGTGGGGGTGGGGTGGG - Exonic
915288848 1:154869602-154869624 GTGGAGGATGGCGGTGGAGTTGG + Exonic
915472711 1:156135382-156135404 GTTGGGGGTGGGGGTGGGGGTGG + Intronic
915475431 1:156150168-156150190 GAGGGGGCTGACAGAGGGGTCGG + Intronic
916097047 1:161360576-161360598 GTGGGGGTGGGTGGTGGGGTAGG + Intronic
916214991 1:162386498-162386520 GTAGGAGGTTATGGTGGGGTTGG - Intronic
916368560 1:164061855-164061877 GTGGGGGGTGTGTGTGGGGGAGG - Intergenic
916706627 1:167357365-167357387 GGGGGGGGTGGGGGGGGGGTGGG - Intronic
917025022 1:170631854-170631876 GTGGGGGGGGACGGGGGTGGGGG - Intergenic
917232425 1:172852542-172852564 CTGGGGCCTGTCGGTGGGGTGGG - Intergenic
917634485 1:176921738-176921760 GTGTGAGGTGAGGTTGGGGTTGG - Intronic
917651929 1:177086181-177086203 GTGGGGGTGGGTGGTGGGGTGGG - Intronic
918015759 1:180631414-180631436 GTTGGGGGTGAGGGTTGGGAGGG - Intergenic
918180354 1:182081764-182081786 GGGGGGGGTGGGGGTGGGGGTGG + Intergenic
918248289 1:182679817-182679839 GTAGGGGGTGCGGGTGGAGTGGG - Intronic
918546774 1:185693558-185693580 CTGGGGGGTGAGGGTGGGATGGG + Intergenic
918672653 1:187239146-187239168 GTGGTGGGGGAGGGTGTGGTGGG + Intergenic
918833356 1:189428033-189428055 GTGGGGGGTGGGGGTTGTGTAGG + Intergenic
919652483 1:200164121-200164143 GTGGCGGGTGAGGGTGGGGCAGG - Intronic
919738405 1:200968026-200968048 GTGGGGAGCGAGGGTGGGGCGGG + Intergenic
919918560 1:202154117-202154139 GTGTGGGGTGGGGGTGGGGTGGG + Intronic
920556269 1:206907106-206907128 GGGGGGGGTGGGGGCGGGGTGGG + Intronic
920865731 1:209751813-209751835 CTTGGGGGTGAAGGTGGGGTAGG - Intergenic
920879189 1:209864386-209864408 GTGGGTGGTGGGGGTGGGGGTGG + Intergenic
921013813 1:211168939-211168961 GTGGAGGGTAAACGTGGGGTTGG - Intergenic
921847233 1:219897222-219897244 GGTGGGGGTGGGGGTGGGGTGGG - Intronic
921945241 1:220881596-220881618 GTGTGCGTGGACGGTGGGGTGGG + Intronic
922032376 1:221813587-221813609 GATGGGGGTGAGGGTGGGGGTGG + Intergenic
922135810 1:222825161-222825183 GTGGTGGGGGATGGTGGGGGTGG + Intergenic
922324213 1:224513339-224513361 GTTGGGGGTGGGGGTGGGGGTGG + Intronic
922434811 1:225593399-225593421 GTGGGGGGGGGGGGGGGGGTGGG + Intronic
922478808 1:225924502-225924524 GTGGGGGGGGGGGGTGGGGGCGG - Intergenic
922620176 1:226984035-226984057 GGGGGGGGGGACGGTGTGGAGGG + Intronic
922950509 1:229555119-229555141 GTGGGGGGCTTCGGCGGGGTGGG - Intronic
923040301 1:230315187-230315209 GTGGGGGGTGAGGGGGTGGCTGG - Intergenic
923230727 1:231983646-231983668 GGAGGGGGTGGAGGTGGGGTGGG + Intronic
923404434 1:233646035-233646057 GTGAGAGGTGATGGTGGGGATGG + Intronic
923616791 1:235544909-235544931 GTGGTGGTGGAGGGTGGGGTGGG + Intergenic
923724637 1:236495546-236495568 GAGGAGGGTGGAGGTGGGGTGGG - Intergenic
924415007 1:243849922-243849944 GCGGGGGATGGCGGCGGGGTGGG - Intronic
924437613 1:244056658-244056680 GTGGAGGGTGGTGGTGGGGGGGG - Exonic
924580959 1:245323951-245323973 GTGGGAGGTGGAGGTGGGGTGGG + Intronic
924580995 1:245324062-245324084 GTTGGAGGTGGAGGTGGGGTGGG + Intronic
1062795058 10:338867-338889 GTGCAGGGTGCAGGTGGGGTGGG - Intronic
1062818400 10:516768-516790 GTGGGGGGGGACAGGGGGTTGGG + Intronic
1063357350 10:5413016-5413038 GGGGGAGGTGACCGCGGGGTTGG + Intronic
1063458310 10:6200675-6200697 GCGGGGGGTGGTGGTGGGGCGGG + Intronic
1063477311 10:6340537-6340559 GTGGGGGATGAGGGTGGGAAGGG + Intergenic
1063655018 10:7979810-7979832 GTGGGGTGGGGTGGTGGGGTGGG + Intronic
1064048638 10:12042265-12042287 GTGGGGCGAGAAGTTGGGGTTGG - Intronic
1064131559 10:12714200-12714222 GTGGGGGGTGACGGTGGGGTCGG - Intronic
1064608604 10:17072955-17072977 TTGGGGGTTGAGGGTGGGATGGG - Intronic
1065056971 10:21855781-21855803 GGGCAGGGTGGCGGTGGGGTAGG - Intronic
1065293931 10:24257337-24257359 GTGGGGGGTGGAGGGAGGGTTGG + Intronic
1065589699 10:27252042-27252064 GTGGTGGGGTAGGGTGGGGTGGG + Intergenic
1066028507 10:31391417-31391439 GTTGGTGGTGATGGTGGAGTTGG + Intronic
1066068319 10:31778658-31778680 GGTGGGGGTGACGGTGGAGGGGG - Intergenic
1066533359 10:36364342-36364364 CTTGGAGGTGAGGGTGGGGTTGG - Intergenic
1066582895 10:36899936-36899958 GTGGGGGGTTACGGTGGTACAGG - Intergenic
1067152885 10:43751090-43751112 GTGGGGGGTGGGGTGGGGGTGGG - Intergenic
1067181089 10:43986498-43986520 GTGGGTGGGGAGGGTGGGGAAGG - Intergenic
1067295981 10:44975422-44975444 GTGGGGGTGGAAGGTGGGGATGG - Intronic
1067379401 10:45759288-45759310 GTCGGGGGTGGGGGGGGGGTGGG - Intronic
1067691967 10:48507897-48507919 CTGGGGGGTGGGGGTGGGGTGGG + Intronic
1067713643 10:48670810-48670832 GCGGGGGGTGGGGGTGGGGTGGG + Intergenic
1067774532 10:49153366-49153388 ATTGGGGGTGAGGGTGGGGTTGG - Intergenic
1068350378 10:55837058-55837080 GTGGAGGGTGTCCCTGGGGTGGG - Intergenic
1068551336 10:58411249-58411271 CTGGGGCCTGTCGGTGGGGTAGG - Intergenic
1069341099 10:67409581-67409603 GTTAGGGGTGGAGGTGGGGTAGG + Intronic
1069724629 10:70569175-70569197 GAGGGGGGTGGGGGTGGGGGTGG + Intergenic
1070369688 10:75770661-75770683 GTGGAGGCCGAGGGTGGGGTGGG + Intronic
1071547299 10:86538430-86538452 GTGGGGGGCGTGGGTGGGGTGGG - Intergenic
1071880157 10:89888629-89888651 GTGGGGGGGTAGGGGGGGGTGGG - Intergenic
1072004425 10:91230691-91230713 GTGGGGGATGGAAGTGGGGTAGG - Intronic
1072257004 10:93630383-93630405 GTGGGGGGTGACAGTTGGGGAGG - Intronic
1072321632 10:94255958-94255980 GTGGGGAGAGAGGGAGGGGTGGG - Intronic
1072355321 10:94604450-94604472 GTGGGGGGTGGCGGGGGGTGGGG - Intronic
1073037379 10:100573666-100573688 GTGGGGCCTGGCTGTGGGGTAGG - Intergenic
1073044084 10:100625982-100626004 GAGGGAGGTGAAGGTGGGGCGGG + Intergenic
1073165620 10:101446990-101447012 GTGGGGGGTGGTGGGGGGGCCGG + Intronic
1073338851 10:102729979-102730001 GTGGTGGGTGACTTTGGGTTAGG + Intronic
1073439394 10:103543766-103543788 CTGGGGGCTGAAGGTGAGGTGGG + Intronic
1073578289 10:104642378-104642400 AGGGGGGGTGGGGGTGGGGTGGG - Intronic
1073736001 10:106347430-106347452 GTGGGGGGTGATGGTAGTTTGGG - Intergenic
1073825218 10:107312996-107313018 GGTGGGGGTGTGGGTGGGGTGGG + Intergenic
1073904914 10:108267365-108267387 GTTGGGTGTGATGGTGGGGGTGG - Intergenic
1074438413 10:113454230-113454252 GTGCGGGGTGGCAGTGGGGTGGG + Intergenic
1074502988 10:114043519-114043541 GTGGGGGCTGAGGGAGGGGACGG + Intergenic
1074709950 10:116169048-116169070 GTGGGAGGTGACAGAGGGGATGG - Intronic
1074932811 10:118146310-118146332 GTGAGAGGTGGCAGTGGGGTTGG - Intergenic
1075251759 10:120884205-120884227 GTGGGAGGTGTGGGTGGGGTTGG + Intronic
1075604855 10:123797275-123797297 CTGGGTAGTGGCGGTGGGGTAGG - Intronic
1076290727 10:129343523-129343545 GTGGGAGGTGTGGGTGGGGAAGG + Intergenic
1076441354 10:130483440-130483462 GTGTGGGGTGACATTGGGGAGGG + Intergenic
1076601422 10:131659118-131659140 GTGGGGAGTGGAGGTTGGGTGGG + Intergenic
1076613197 10:131738971-131738993 GTGGGGAGCGAGCGTGGGGTGGG - Intergenic
1076733864 10:132450361-132450383 GTGGGGGCTGGGGTTGGGGTGGG - Intergenic
1076773372 10:132679310-132679332 GAGGAGGGTGAGGGTGGAGTAGG + Intronic
1076948122 10:133665458-133665480 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076949112 10:133668768-133668790 GCGGGGGGTGGGGGTGGGGAGGG - Intronic
1076949511 10:133670140-133670162 GGGGGGGGTGGTGGTGGGGGAGG - Intronic
1076950096 10:133672067-133672089 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076950495 10:133673439-133673461 GGGGGGGGTGGTGGTGGGGGAGG - Intergenic
1076951080 10:133675366-133675388 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076952070 10:133678676-133678698 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076953059 10:133681986-133682008 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076953458 10:133683358-133683380 GGGGGGGGTGGTGGTGGGGGAGG - Intergenic
1076954043 10:133685285-133685307 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076955027 10:133741637-133741659 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076956016 10:133744947-133744969 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076957006 10:133748257-133748279 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076957993 10:133751566-133751588 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076958393 10:133752938-133752960 GGGGGGGGTGGTGGTGGGGGAGG - Intergenic
1076958978 10:133754865-133754887 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076959967 10:133758175-133758197 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1076960366 10:133759547-133759569 GGGGGGGGTGGTGGTGGGGGAGG - Intergenic
1076960951 10:133761474-133761496 GCGGGGGGTGGGGGTGGGGAGGG - Intergenic
1077155332 11:1088547-1088569 GTGGGCTGTGACTGTGGGCTGGG + Intergenic
1077176455 11:1193334-1193356 GTGGGTGCTGAGGGTGGGGCAGG + Intronic
1077249157 11:1553136-1553158 GTGGGGGGTGGGGGGGGGGGAGG + Intergenic
1077349465 11:2085766-2085788 ATCGGGGGTGGCAGTGGGGTGGG + Intergenic
1077435528 11:2537031-2537053 GAGGGGGGTCACAGTGGAGTAGG - Intronic
1077460941 11:2709221-2709243 CTGGGGGGTGGGGGTGGGGGGGG - Intronic
1077520834 11:3032969-3032991 GGGGGAGGTGACGGTGAGGTGGG + Intronic
1078590960 11:12640842-12640864 GTGGGGGGAGGTGGTGGGGGGGG - Intergenic
1078811140 11:14764853-14764875 GTGGGGGGAGGGGGAGGGGTAGG - Intronic
1079688835 11:23397394-23397416 GTGGGGGGTGGCGGGGGGGGTGG - Intergenic
1079726549 11:23886829-23886851 GCGGGGGGTGGGGGTGGGGGTGG - Intergenic
1080927865 11:36776963-36776985 GTGGGGTGGGGGGGTGGGGTGGG + Intergenic
1081534317 11:43986294-43986316 GTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1081576659 11:44322913-44322935 GTGGGGGCTCAGGGTGGGGAGGG + Intergenic
1081647075 11:44797476-44797498 GTGAGGGATGATGGCGGGGTGGG + Intronic
1081796795 11:45826078-45826100 GTGGAGGGTGCCTGTGGGCTGGG + Intergenic
1081961523 11:47141258-47141280 GTTGGGGAAGACGGTGGAGTGGG - Intronic
1082864707 11:57888047-57888069 GGGGGGGCGGAGGGTGGGGTGGG - Intergenic
1083213896 11:61206645-61206667 CTGGGGAGTGAGAGTGGGGTAGG - Intronic
1083216780 11:61225474-61225496 CTGGGGAGTGAGAGTGGGGTAGG - Intronic
1083219662 11:61244300-61244322 CTGGGGAGTGAGAGTGGGGTAGG - Intronic
1083264697 11:61541326-61541348 GAGGGGGGTGATGTTGGGGATGG + Intronic
1083267870 11:61555289-61555311 GAGGGGGGCGACGGTGGGCCCGG - Intronic
1083289002 11:61679765-61679787 GTGGGGGGTGGGGGGGTGGTAGG + Intergenic
1083580097 11:63819102-63819124 GTGGGTGGGGTGGGTGGGGTGGG + Intronic
1083703991 11:64500524-64500546 GTGGGGGATGGGGGTGGGGGTGG + Intergenic
1083897776 11:65628758-65628780 GTGGGGGGTGGTGGGGGGCTGGG + Intronic
1083995448 11:66269326-66269348 AAGGGGTGTGACGGTGGCGTTGG - Intronic
1084185826 11:67470418-67470440 GTGGTGGGGGGCGGTGGGGGTGG + Intergenic
1084194708 11:67517867-67517889 GCTGGGGGTGGCGGTGGGGCGGG + Intergenic
1084330327 11:68426192-68426214 GTGGGGGCTGGCAGTGGGGTGGG + Intronic
1084475460 11:69386241-69386263 GTGGTGGCTGAGGGTGGGGCAGG + Intergenic
1084692786 11:70736773-70736795 GAAGGGTGTGAGGGTGGGGTGGG - Intronic
1084907420 11:72358802-72358824 GGGGGGGGTGGAGGAGGGGTGGG - Intronic
1084951971 11:72671488-72671510 GTGGGGGGTGGGGGCGGGGGTGG - Intronic
1085344993 11:75762952-75762974 GGGTGGGGTGAGGGTGGGGGAGG - Intronic
1085509047 11:77076513-77076535 CTGAGGGGTGAGGGTGGGGAGGG - Intronic
1085521999 11:77144476-77144498 GTGGGGGCTGCAGGAGGGGTGGG + Intronic
1085848603 11:80094895-80094917 GTTGGGGGTGGCGGTTGGGGAGG - Intergenic
1086046088 11:82533773-82533795 GTGGGGGAGGAAGGTGGGGCGGG - Intergenic
1086242395 11:84711405-84711427 GTGGGGGGTGGGGGAGGGGGTGG - Intronic
1086460147 11:86997966-86997988 GTGGGGGGTGGGGGTGGGAATGG + Intergenic
1087005233 11:93464043-93464065 GTGGGGTGGGAGGCTGGGGTAGG + Intergenic
1087585993 11:100122202-100122224 GAACGGGGTGATGGTGGGGTGGG + Intronic
1087794835 11:102444539-102444561 GTCGTGGGTGGGGGTGGGGTGGG + Intronic
1087926522 11:103924967-103924989 CTGGGGGCTGTCGGTGGGTTGGG - Intronic
1088167665 11:106957315-106957337 GTGGGGGTTGCTGGTGGGGAGGG - Intronic
1088269503 11:108019195-108019217 GGTGGGGGTGGGGGTGGGGTGGG + Intronic
1088595366 11:111436911-111436933 GGGCGGGGTGATGGTGGGGAGGG - Intronic
1088657349 11:112013313-112013335 TCGGGGGGTGGGGGTGGGGTGGG + Intronic
1088863291 11:113821900-113821922 GGAGGGTGTGAGGGTGGGGTGGG + Intronic
1088911784 11:114197669-114197691 GTGGGGGCAGGGGGTGGGGTGGG + Intronic
1089453829 11:118614266-118614288 GTGGGGGGTGGGGGTGGCATTGG - Intronic
1089775152 11:120830856-120830878 GTGGGGGGTGGGGGTGATGTGGG - Intronic
1090032339 11:123217827-123217849 TTGGAGGGTGAGGGTGGGGGGGG - Intergenic
1090242142 11:125191639-125191661 GTGGGGCGTGTGGTTGGGGTGGG + Intronic
1090362848 11:126185535-126185557 GCTGGGGGTGAGGGTGGGGTAGG - Intergenic
1090651572 11:128810924-128810946 ATGGCGGGGGACGTTGGGGTTGG - Exonic
1090801368 11:130174510-130174532 GTGTGGGGTGGGGGTGGGGGTGG + Intronic
1090915515 11:131159289-131159311 GTGTGGGCCGAAGGTGGGGTTGG - Intergenic
1091221791 11:133934147-133934169 GTGGGTGGTGACGCTGGCGCTGG + Intronic
1091235738 11:134020896-134020918 GGAGGCGGTGACGGTGGGGGAGG + Intergenic
1091588292 12:1828237-1828259 GAGGGGGGTGCGGGTTGGGTGGG + Intronic
1091590554 12:1840452-1840474 GTGGGGGGCGGCGGGGGGCTGGG + Intronic
1091850377 12:3692506-3692528 GCTGGGGGTGGGGGTGGGGTTGG + Intronic
1091977105 12:4834308-4834330 GTGAGGGGTGACAGCTGGGTTGG + Intronic
1092170589 12:6371543-6371565 GTGAGGGTGGACGGTGGGGGTGG + Intronic
1092278797 12:7083332-7083354 GTTGGTGGTGATGGTGGTGTTGG + Intronic
1092278918 12:7085147-7085169 GTTGGTGGTGATGGTGGTGTTGG + Intronic
1092726513 12:11491526-11491548 CTGGGGGGTGTCGGTGGGGAGGG + Intronic
1092757534 12:11777744-11777766 GTGGGGGGTGGAGGTGGGTCAGG - Intronic
1093053497 12:14532082-14532104 GTGAGGAGTGAAGGTGGGGGAGG - Intronic
1093653883 12:21674104-21674126 CTGGGGGGTGGGGGTGGGGGTGG + Intronic
1093896935 12:24584333-24584355 GTGGGGCGGGAGGGTGGGGGTGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095289348 12:40459517-40459539 GTGAGGGGTGAGGGAGAGGTGGG - Intronic
1095991470 12:48037451-48037473 GTGAGGGGTGAGGGTGGGAAAGG + Intergenic
1096023891 12:48344846-48344868 GTGGGGGAAGAGGTTGGGGTGGG - Intronic
1096106486 12:48999293-48999315 GTGGGGGGCCGGGGTGGGGTGGG - Exonic
1096233401 12:49909991-49910013 GTGTGGGTTGGCGGTGGGGAGGG + Intergenic
1096436154 12:51592047-51592069 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1096518606 12:52171717-52171739 GGGGTGGGGGACGGGGGGGTGGG + Intronic
1096627340 12:52903874-52903896 GGGGGCGGTGTGGGTGGGGTGGG - Intronic
1096779698 12:53984870-53984892 GAGGGGGGTGGGGGTGGGGGTGG - Intergenic
1096790798 12:54043582-54043604 TTGAGGGGTGGGGGTGGGGTGGG - Intronic
1096843064 12:54390839-54390861 GTGGGGGAAGACGCTGGGGCGGG + Intronic
1096857872 12:54498141-54498163 GATGGGGGTGAGGGTGGGGATGG + Intronic
1097197390 12:57250813-57250835 GCGGGGGGTGGGGGTGGGGGTGG - Intronic
1097246486 12:57610322-57610344 ATGGGGGCTCGCGGTGGGGTCGG + Intronic
1097707483 12:62882909-62882931 CTGGGGAGTGGCGGTGGGGGTGG - Intronic
1097769544 12:63566457-63566479 GCGAGGGGTTAGGGTGGGGTGGG - Intronic
1098105776 12:67068678-67068700 CTGGGGGGTGATGGTGGGCATGG - Intergenic
1098172744 12:67763093-67763115 GTGGGGGGTGGCGGCGGTGCGGG - Intergenic
1098477387 12:70920845-70920867 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1098597956 12:72295123-72295145 GTGGGGGGTGGCTGGGGGATGGG + Intronic
1098816511 12:75172044-75172066 TTGGGGGGTGAGGGTGGGTATGG - Intronic
1100398553 12:94206276-94206298 GTTGGGGGTGAGGGAGGGGGCGG + Intronic
1100473433 12:94914260-94914282 ATGGGAGGTGAGGGTGAGGTGGG - Intronic
1100594143 12:96057103-96057125 GTACGGGGTGGGGGTGGGGTGGG - Intergenic
1100804398 12:98266335-98266357 GTGGGGGGTGAGGGTAAGGATGG - Intergenic
1101027187 12:100621860-100621882 GTGGGGAGGGAGGGTGGGGGGGG + Intronic
1101576311 12:106000235-106000257 GTGGGGGCTGAGGATAGGGTGGG - Intergenic
1101640224 12:106581938-106581960 CTGGGGGACGGCGGTGGGGTGGG + Intronic
1101763436 12:107677780-107677802 GGGGGTGGGGATGGTGGGGTGGG - Intergenic
1102013148 12:109631360-109631382 GTGGGGGGTTTCCATGGGGTGGG + Intergenic
1102053894 12:109881908-109881930 GTGGAGGGTGGGGGAGGGGTGGG - Intergenic
1102073877 12:110044624-110044646 GTGGAGGGTGTGTGTGGGGTGGG - Intronic
1102480041 12:113216597-113216619 GGGGAGGTTGACGGTGGGGCAGG + Intronic
1102533159 12:113561655-113561677 GGGAGGGGTGATGGTGGGGGAGG + Intergenic
1102551234 12:113693698-113693720 GTTGGGGGAGACAGTGGGGCTGG + Intergenic
1102552115 12:113698864-113698886 GTGGGGGGTCAGGGGGAGGTGGG + Intergenic
1102554612 12:113718909-113718931 GTGGAGAGTGATGGAGGGGTAGG - Intergenic
1102657034 12:114490678-114490700 GAGCGGGGGGAGGGTGGGGTGGG + Intergenic
1102704728 12:114871096-114871118 GTGGGGTGTGAAGTAGGGGTAGG + Intergenic
1103229692 12:119318777-119318799 GTGGGTGGGGAGGGTGGAGTAGG + Intergenic
1103481622 12:121253682-121253704 GGGTGGGGTGATGGTGGGCTGGG - Intronic
1103553343 12:121751351-121751373 GTGGGGTGTGGGTGTGGGGTGGG - Intronic
1103553359 12:121751394-121751416 GTGTGGGGTGAGAGTGGGGTGGG - Intronic
1103561161 12:121793889-121793911 GCGGAGGGTGGCGGTGGGTTGGG - Exonic
1103720736 12:122974106-122974128 AGAGGGGGTGAGGGTGGGGTGGG + Intronic
1103722836 12:122983754-122983776 GTGGGGCGTGGGGGTGTGGTGGG + Exonic
1104188427 12:126454833-126454855 GTTGGGGGTGGAGGTGGGGAAGG - Intergenic
1104461425 12:128959410-128959432 GTGGGGGGGGACGGGTGGGGAGG + Intronic
1104489940 12:129184857-129184879 GTTTGGGGTGAGGGTGGGGGTGG + Intronic
1104636629 12:130441764-130441786 GTGGGGAGGGAAGGTGGGGCAGG - Intronic
1104860002 12:131918781-131918803 GTGTGGGGTGTCGGGGGTGTGGG + Intronic
1104862061 12:131929120-131929142 CTAGGGGGTGGGGGTGGGGTGGG - Intergenic
1105210667 13:18254963-18254985 GTGGGGAGGGAGGGTGGGGAGGG + Intergenic
1105351419 13:19619680-19619702 GTGCAGGGTGGTGGTGGGGTGGG - Intergenic
1106547239 13:30741542-30741564 TTGGGGGGTGGGGGTGGGGAGGG - Intronic
1106604330 13:31213613-31213635 GCGGGGGGGGGGGGTGGGGTGGG - Intronic
1107238086 13:38197474-38197496 GTGGGGGGTGGGGGTGCGGGGGG + Intergenic
1107709121 13:43135106-43135128 GGGGTGGGTGAGGGAGGGGTAGG - Intergenic
1107967175 13:45607836-45607858 TTCAGGGGTGGCGGTGGGGTTGG - Intronic
1109106171 13:58253425-58253447 GGGGGGGGTGGGGGTGGGGGTGG - Intergenic
1109860364 13:68190451-68190473 GTGGGGGGCGGGGGTGGGGGGGG - Intergenic
1110558219 13:76884910-76884932 GTGGTAGGTGGGGGTGGGGTGGG + Exonic
1110863115 13:80365980-80366002 GTGAGGGGGGAAGGTGGGGAAGG + Intergenic
1111267334 13:85834202-85834224 GTGGTGGGGGAGGGAGGGGTTGG + Intergenic
1112278314 13:98040830-98040852 TTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1112551797 13:100428338-100428360 GGGGGGGGTGGGGGTGGGGGTGG - Intronic
1112882040 13:104120128-104120150 GTGTGGATTGACGGTGGGTTTGG + Intergenic
1112981849 13:105394358-105394380 GTGTGTGGTGAGGGGGGGGTTGG + Intergenic
1113815833 13:113170298-113170320 GCGGGGGGTGGGGGTGGGGGTGG + Intronic
1113875032 13:113588892-113588914 GTGAGTGGTGATGGTGGAGTTGG + Intronic
1113966234 13:114155355-114155377 GTGGGGTGTGAGGGTGAGGGTGG + Intergenic
1113966353 13:114155683-114155705 GTGGGGGTGGAGGGTGGGGAGGG + Intergenic
1113976946 13:114234913-114234935 GTGGGGGGTGCGGGTGTGGGTGG + Exonic
1113987129 13:114326993-114327015 GTGGGGGGTGGGGATGGGGAGGG - Exonic
1114063034 14:19037657-19037679 GCGCGGGGTGGGGGTGGGGTGGG + Intergenic
1114099225 14:19362338-19362360 GCGCGGGGTGGGGGTGGGGTGGG - Intergenic
1114207225 14:20583634-20583656 GTGTGGGGGGAGGGTGGGGAGGG - Exonic
1114234502 14:20812657-20812679 CTGTGGGGTGGGGGTGGGGTGGG - Intergenic
1114289131 14:21273224-21273246 TTGGGGGGTGGGGGTGGGGATGG + Intergenic
1114450141 14:22819968-22819990 GGGGGGGGTGAGGCTGAGGTAGG - Intronic
1115237484 14:31221839-31221861 GTTGGGGGTGGTGCTGGGGTCGG + Intergenic
1115501759 14:34056351-34056373 GCGGGGGGGGGGGGTGGGGTGGG - Intronic
1115888734 14:38003728-38003750 GTGGGGGGCGGGGGTGGGGATGG + Intronic
1116080487 14:40164251-40164273 CGGGGGGGTGGCGGGGGGGTGGG + Intergenic
1116159467 14:41250644-41250666 GTGTTGGGTGATGGTGGTGTGGG + Intergenic
1116552790 14:46263716-46263738 GTCGGGGGTGTAGGTGGGGAGGG + Intergenic
1116651925 14:47604489-47604511 TAGGGGGGTGAGGGTGGGGGGGG - Intronic
1116671830 14:47851954-47851976 GTGGGGCCTGTCGGGGGGGTTGG + Intergenic
1117246577 14:53892305-53892327 TGGGGGGGTGGAGGTGGGGTGGG - Intergenic
1117275300 14:54187834-54187856 GTTGGGGGTGGGGGTGGGGTGGG - Intergenic
1117464303 14:55976703-55976725 GTTGGGGGTTGGGGTGGGGTGGG - Intergenic
1117478014 14:56117674-56117696 TTGGGGGGTGGCGGGGGGATGGG - Intergenic
1118098676 14:62569773-62569795 GTGGTGGGTGGGGGTGGGGGTGG + Intergenic
1118148263 14:63163956-63163978 GTGGGGGTGGGGGGTGGGGTGGG - Intergenic
1118152528 14:63204945-63204967 GTGGTGGGGGACGGTGCCGTGGG + Exonic
1118452497 14:65916912-65916934 GTTGGGGATGATGTTGGGGTGGG + Intergenic
1118715504 14:68556867-68556889 GTGTGTGGAGAAGGTGGGGTGGG - Intronic
1118883736 14:69850028-69850050 GGAGGGGGTGAAGGTGGGGTGGG + Intergenic
1118985699 14:70752858-70752880 GTCGGGGGTGAGGCAGGGGTGGG + Intronic
1118992278 14:70808428-70808450 ATGGGGGGCGGCGGGGGGGTGGG + Intronic
1119128520 14:72150743-72150765 GTGGGAGGTGACTGGGTGGTAGG - Intronic
1120321257 14:82964442-82964464 CTGGGGCCTGTCGGTGGGGTAGG - Intergenic
1120852818 14:89186537-89186559 GAGGGTGGAGAGGGTGGGGTAGG + Intronic
1120885137 14:89445946-89445968 GTGGGGGGTGGCGGGGGTGGAGG + Intronic
1121168788 14:91836203-91836225 GTGGGGGGTGCCTGTGAGGGCGG - Intronic
1121377983 14:93431157-93431179 GTGGGGGCTGAGGTTGGGGCGGG + Intronic
1121453183 14:94022413-94022435 GTTGGGGGTGAAGATGGGGAGGG - Intergenic
1121618961 14:95332848-95332870 GTGTGGGGTGTGGGTGGGGCAGG + Intergenic
1121717672 14:96087943-96087965 GTGGGGGGTGGGGGTGGGGGTGG - Exonic
1121845370 14:97167952-97167974 GTGGGGGGAGAGGGAGGGGGAGG + Intergenic
1122172587 14:99889284-99889306 CTGGTGGGTGGTGGTGGGGTCGG - Intronic
1122270705 14:100567490-100567512 GTGGTGGTTGGGGGTGGGGTGGG + Intronic
1122437912 14:101711995-101712017 GGGGGAGATGACGGTGGGGGGGG - Intergenic
1122450722 14:101804730-101804752 GTGGGGGTTGGCGGGGGGGATGG + Intronic
1122472756 14:101982658-101982680 TTGGGGGGTGGTGGGGGGGTGGG - Intronic
1122606113 14:102948366-102948388 GTGAGGGGGGAGGGTGGGGTGGG + Intronic
1122748001 14:103911015-103911037 GTGGGGGGTGGGGGTGGGGAGGG + Intergenic
1122791357 14:104185450-104185472 GTGTGGGGTGGGGGTGGAGTGGG + Intergenic
1122837558 14:104437518-104437540 GTGGGTGGTGACACTGGGCTGGG + Intergenic
1122922075 14:104884400-104884422 GTGGGGGCGGGCGGTGGGGTCGG - Exonic
1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG + Intergenic
1123117100 14:105899719-105899741 GTGGGGTGTGCAGGTGGGGGTGG + Intergenic
1123119175 14:105909028-105909050 GTGGGGTGTGCAGGTGGGGGTGG + Intergenic
1202848733 14_GL000225v1_random:2203-2225 GTGGGGAGTGGGGGTGGGGAGGG - Intergenic
1202853913 14_GL000225v1_random:37970-37992 GTGGGGGGTGGGGGTGGGATGGG - Intergenic
1202856464 14_GL000225v1_random:54434-54456 GTTGGGGGTGGGGGTGGGGATGG - Intergenic
1202859255 14_GL000225v1_random:71597-71619 GTGGGGGGTGGGGGTGGTGAGGG + Intergenic
1202863990 14_GL000225v1_random:103943-103965 GTGGGGTGTGGCGGTGGGGAGGG + Intergenic
1202868443 14_GL000225v1_random:137320-137342 GGGCGTGGTGACGGTGGGGCCGG + Intergenic
1123940081 15:25212523-25212545 GGGGGGGGTGGTGATGGGGTCGG + Intergenic
1124345409 15:28918624-28918646 GTTGGGGGTGGGGGTGGGGCTGG + Intronic
1124426787 15:29570043-29570065 GTGGGGGTGGGGGGTGGGGTGGG - Intronic
1124883306 15:33661540-33661562 GTGGTGGGTGAGGCTGGGGGAGG + Intronic
1124955885 15:34360085-34360107 ATGGGGGGTGGCGGTGGTGGGGG - Intronic
1124959088 15:34381909-34381931 GGTGGGGGTGTGGGTGGGGTGGG - Intronic
1124975714 15:34528130-34528152 GGTGGGGGTGTGGGTGGGGTGGG - Intronic
1124987401 15:34634001-34634023 GTGGGGGATGGGGGTGGGGGAGG + Intergenic
1125300896 15:38252652-38252674 GAGGCGGGAGATGGTGGGGTGGG + Exonic
1125499105 15:40227251-40227273 GTGGGGGGATGCGGGGGGGTGGG - Intergenic
1125524007 15:40364147-40364169 GTTGGGGGTGGAGGTGGGGTGGG - Intronic
1126002788 15:44227365-44227387 CTGGGGCCTGTCGGTGGGGTGGG + Intergenic
1126100063 15:45113426-45113448 CTGCGGGGTGAGGGTGGGGGTGG + Intronic
1126240185 15:46433038-46433060 GGTGGGGGTGGGGGTGGGGTGGG + Intergenic
1126358956 15:47825703-47825725 GTGGTTGGTGAAGGTGGGGCAGG - Intergenic
1126554942 15:49976246-49976268 ATGGAGGGTGGGGGTGGGGTGGG - Intronic
1127426406 15:58863292-58863314 GTGGGGGGGGGCGGGGGGGGTGG - Intergenic
1127801191 15:62478657-62478679 GTAGGAGGTGAGGGTGGGTTAGG + Intronic
1128285025 15:66429668-66429690 GTTGGGGGGGACGGGGGGGGGGG - Intronic
1128988206 15:72236568-72236590 GTGGGGGGTGGCCATGGGGAGGG + Intergenic
1129178893 15:73859272-73859294 GTGGGGGGGGCGGGGGGGGTGGG - Intergenic
1129208502 15:74051955-74051977 GTGGGGGGTGACGGCGAGATGGG - Intergenic
1129442249 15:75589788-75589810 GTGGGGGGTGAGGGAGAAGTGGG + Intergenic
1129577256 15:76763345-76763367 GTGGGGGGTGGTGGGGGGGCAGG + Intronic
1129770037 15:78197247-78197269 GTGGGGAGTGACCGTGGAATAGG + Intronic
1129934423 15:79437666-79437688 GTGTGGGGTGTGGGTGGCGTGGG + Intronic
1129934446 15:79437757-79437779 GTGTGGGGTGTGAGTGGGGTGGG + Intronic
1129934476 15:79437861-79437883 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934500 15:79437947-79437969 GTGTGGGGTGTGGGTGGGGTGGG + Intronic
1129934527 15:79438033-79438055 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934536 15:79438064-79438086 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934545 15:79438095-79438117 GTGTCGGGTGTGGGTGGGGTGGG + Intronic
1129934572 15:79438196-79438218 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934581 15:79438227-79438249 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934590 15:79438258-79438280 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934624 15:79438387-79438409 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934675 15:79438559-79438581 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934685 15:79438590-79438612 GTGTGGGGTGTGGGTGGGGTGGG + Intronic
1129934709 15:79438669-79438691 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934727 15:79438727-79438749 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934753 15:79438820-79438842 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934762 15:79438851-79438873 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934780 15:79438913-79438935 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934789 15:79438944-79438966 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934822 15:79439065-79439087 GTGTGGGGTGTTGATGGGGTGGG + Intronic
1129934840 15:79439123-79439145 GTGTGGGGTGTGGATGGGGTGGG + Intronic
1129934848 15:79439154-79439176 GTGTGGGGTGTGTGTGGGGTGGG + Intronic
1129934870 15:79439236-79439258 TTGTGGGGTGTGGGTGGGGTGGG + Intronic
1130300070 15:82673999-82674021 GTGGCGGGGGATGGGGGGGTTGG - Intronic
1130599062 15:85264024-85264046 GTGAGGGGTGACCGGGGGTTGGG + Intergenic
1130599285 15:85264906-85264928 GTGAGGGGTGACCGGGGGCTGGG + Intergenic
1131291703 15:91112122-91112144 GGGTGGGGTGAGGGTTGGGTCGG + Intronic
1131553945 15:93380546-93380568 GGGTGGGGTGACGGTGGGCAGGG - Intergenic
1131825640 15:96321236-96321258 TTGGGGGGTGGTGGTGGGGGGGG + Intergenic
1132130219 15:99270427-99270449 GTGGGAGCTGAGGGTGGGGGCGG - Intronic
1132145203 15:99425412-99425434 GTGGAGGGTGAGGCTGGGGTGGG + Intergenic
1132235132 15:100214170-100214192 GAAGGGGGAGACGGTGGGGTTGG - Intronic
1132373138 15:101311671-101311693 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373146 15:101311696-101311718 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373154 15:101311721-101311743 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373162 15:101311746-101311768 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373170 15:101311771-101311793 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373178 15:101311796-101311818 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373187 15:101311821-101311843 GTGAGGGGTGACCATGGGGTGGG - Intronic
1132373195 15:101311846-101311868 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373203 15:101311871-101311893 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373211 15:101311896-101311918 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373233 15:101311973-101311995 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373241 15:101311998-101312020 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373249 15:101312023-101312045 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373257 15:101312048-101312070 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373272 15:101312099-101312121 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373280 15:101312124-101312146 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373288 15:101312149-101312171 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132501360 16:286041-286063 GTTGGGGTTGAGGTTGGGGTTGG - Intronic
1132546105 16:534195-534217 GTGGGAGGCGACGGTGAGGGCGG + Intronic
1132664639 16:1075983-1076005 GTGGGGGGAGAGGGAGGGGGAGG - Intergenic
1132674309 16:1115373-1115395 TGGGGGTGTGACGGTCGGGTGGG - Intergenic
1132685875 16:1161860-1161882 GTGGGGTGGGTCCGTGGGGTGGG + Intronic
1132689176 16:1174907-1174929 GTTGGGGGTGAAGGTGCGGGTGG - Intronic
1132789640 16:1678438-1678460 GTGTGGGGTTGGGGTGGGGTTGG + Intronic
1133069437 16:3235655-3235677 GTGGGGGGTGGCGGGGTGGGGGG - Intronic
1133335700 16:5005406-5005428 ATGGGAAGTGACGGTGGGGTGGG + Intronic
1134141910 16:11727668-11727690 GTGGAAGGTTATGGTGGGGTGGG - Intronic
1134152217 16:11813829-11813851 GGGGGGCGTGGCGGGGGGGTGGG + Intergenic
1134183690 16:12066733-12066755 GTAGGAGGGGATGGTGGGGTGGG + Intronic
1134408599 16:13984130-13984152 TTGGGGGGTGAGGGATGGGTCGG - Intergenic
1134471502 16:14530338-14530360 GTGGCGGGTGTTGGTGGGCTGGG - Intronic
1135209727 16:20514427-20514449 GTGGGGAGTGGCTGTTGGGTAGG + Intergenic
1135631015 16:24035606-24035628 GGGGAGGGTGGCGGAGGGGTGGG + Intronic
1136605168 16:31329091-31329113 CTGGGGGGTGGAGATGGGGTGGG - Intronic
1136893199 16:33982132-33982154 GTGGGGGGGGCGGGGGGGGTGGG + Intergenic
1137485479 16:48887163-48887185 GGTGGGGGTGGCGGTGGGGGAGG - Intergenic
1137569274 16:49554354-49554376 GTGGGCTGTGAAGGTGGTGTGGG - Intronic
1137728223 16:50671076-50671098 GTGTGGGGTGTTGGGGGGGTGGG - Intronic
1137750651 16:50858949-50858971 GGGGGGGGGGACGGGGGGGGCGG - Intergenic
1138104909 16:54282737-54282759 GTGTGGGGTGACGGTGGAGGCGG - Intergenic
1138348118 16:56332284-56332306 GTGGTGGGTGAGGCTGGGGAAGG - Intronic
1138427490 16:56945857-56945879 GTGGGGGGGGGGGGTGGGGGGGG - Intergenic
1138449765 16:57086677-57086699 GCGGGGGGTAGGGGTGGGGTGGG + Intergenic
1139087284 16:63602571-63602593 ATGGGGGGTGAGAATGGGGTTGG + Intergenic
1139364843 16:66427068-66427090 GGGGCCGGTGACGGTGGCGTGGG + Intergenic
1139482224 16:67236854-67236876 GTGGGGGCTGTCTGTGGGGCGGG + Intronic
1139526944 16:67522692-67522714 GAGTGGGGTGAGGGCGGGGTAGG - Intronic
1139648079 16:68346551-68346573 GTGGGTGGTCACGGTGGATTAGG + Intronic
1139949919 16:70663777-70663799 GTGGCGGCTGGGGGTGGGGTGGG + Exonic
1139978053 16:70830599-70830621 GTGGGGGATGACGGTGGCTTAGG + Intronic
1140076377 16:71702944-71702966 GAAGGGTGTGAGGGTGGGGTGGG - Intronic
1141043531 16:80693123-80693145 GTGGGGGTGGATGGCGGGGTGGG + Intronic
1141497552 16:84420348-84420370 GTGGGGAGTGAGTGTGGGTTTGG - Intronic
1141524777 16:84604252-84604274 GTGGAGGGTGAGTGTGGGGTGGG - Intronic
1141533424 16:84662155-84662177 CTGGGAGGTGACGGTGAGGATGG - Exonic
1141685392 16:85567050-85567072 GAGGGGGGTGGGGGTGGGGGTGG - Intergenic
1141688687 16:85584576-85584598 GTGCGGGGAGAGGGAGGGGTGGG - Intergenic
1141699011 16:85633971-85633993 GAGGGGGTTGACGGTGGCGGTGG - Exonic
1141747200 16:85933689-85933711 GAGGGGTGTGATGGTGAGGTTGG + Intergenic
1142070056 16:88086995-88087017 GAGGCGGGTGAGTGTGGGGTGGG - Intronic
1142224824 16:88872272-88872294 GTGGGTGGAGAGGGTGGGGTGGG + Intergenic
1142228420 16:88888478-88888500 TGGGGGGGTGCGGGTGGGGTTGG + Intronic
1142228454 16:88888538-88888560 GGGTGGGGTGGGGGTGGGGTAGG + Intronic
1142240354 16:88941850-88941872 TTGGGGGGTGTGGGGGGGGTGGG + Intronic
1142252205 16:88997112-88997134 GTGGGGACTGAGGGTGGAGTAGG + Intergenic
1142491357 17:281738-281760 GTCCAGGGTGACGGTGGGGAGGG - Intronic
1142575427 17:903890-903912 GTGGGGGGTGAGGTTGGCTTCGG - Intronic
1142605016 17:1076715-1076737 GGGGGGGGTGGGGGTGGGGGGGG + Intronic
1142675690 17:1511866-1511888 GGGGGCGGGGAGGGTGGGGTCGG + Intronic
1142743203 17:1942326-1942348 GTGGGGGGTGCCAGTGGGGAGGG + Intronic
1142762149 17:2049048-2049070 GTGGGGAGTGAAGGAGGGGGTGG + Intergenic
1142903263 17:3026447-3026469 GAGGAGGGCGACAGTGGGGTAGG + Exonic
1143060420 17:4196025-4196047 GTGGGGGGTGGTGGGGGGGGTGG - Intronic
1143148926 17:4795115-4795137 GTGGGGTGTGTGTGTGGGGTGGG - Intergenic
1143563738 17:7709382-7709404 CTGGGGGGTGGAGGTGGGATGGG + Exonic
1143635815 17:8163183-8163205 GGGTGGGGTGGCGGTGGGTTTGG - Intronic
1143702592 17:8672409-8672431 GTGGTGGGTGAGGGTGAGGGCGG - Intergenic
1143714135 17:8755005-8755027 GTGGGCAGTGAAGGGGGGGTGGG + Intronic
1143796959 17:9344683-9344705 GTTGGGGGTGTGGGTGGGGCAGG - Intronic
1143845575 17:9770794-9770816 GTGGGTGGGGATGGTGGGGGTGG + Intergenic
1143970083 17:10789185-10789207 GAGAGGGGTCTCGGTGGGGTGGG - Intergenic
1143983882 17:10894580-10894602 ATAGGGGGTGATGGTGGGTTGGG - Intergenic
1144447693 17:15346131-15346153 GGGTGGGGGGGCGGTGGGGTGGG - Intergenic
1144485020 17:15657081-15657103 GTGGGTGGTGACCATAGGGTAGG - Intronic
1144750122 17:17642725-17642747 GTTGGGGGTGGGGGTGGGGCAGG - Intergenic
1144941839 17:18947562-18947584 GAGCGGGGTGACGGGTGGGTGGG + Intergenic
1145782470 17:27572046-27572068 GTGGAGGGTGAGGATGGGTTTGG - Intronic
1146276175 17:31517192-31517214 GGGGGGGGGGGCGGTGGGGGGGG + Intronic
1146356007 17:32134883-32134905 GTGGGGGTGGAGGTTGGGGTGGG + Intergenic
1146653911 17:34623944-34623966 CTGGGAGCTGATGGTGGGGTGGG - Intronic
1146846294 17:36183624-36183646 GTGTGGGGTGGGGGTGGGATGGG + Intronic
1146904465 17:36609105-36609127 GTGGGGGGCCCCCGTGGGGTGGG - Intergenic
1147178589 17:38671657-38671679 CTTGGGGGTGAGGGTGGGGGTGG - Intergenic
1147325988 17:39669844-39669866 CTGGGGGGTGAGGGTTGGGGAGG + Intronic
1147393060 17:40122049-40122071 GCCGGGGGTGACTGTGGGGGAGG + Intergenic
1147418040 17:40307656-40307678 GTGGTGGTTGATGGGGGGGTGGG + Intergenic
1147910832 17:43855053-43855075 GTGGGGGGTGGTGGTGCGGGGGG - Intronic
1147965960 17:44194291-44194313 GTCGGGGGTGCCGGTGGCTTTGG + Exonic
1148168063 17:45497599-45497621 GTGGGGGTTGGCGCTGAGGTGGG + Intergenic
1148174335 17:45550566-45550588 GTGGTGGGGTAGGGTGGGGTAGG + Intergenic
1148274927 17:46294881-46294903 GTGGTGGGGTAGGGTGGGGTAGG - Intronic
1148280753 17:46345358-46345380 GTGGGGGGTGGCGCTGAGGTGGG - Intronic
1148297034 17:46512460-46512482 GTGGTGGGGTAGGGTGGGGTAGG - Exonic
1148302981 17:46563293-46563315 GTGGGGGGTGGCGCTGAGGTGGG - Intronic
1148361587 17:47016940-47016962 GTGGTGGGGTAGGGTGGGGTAGG - Intronic
1148431986 17:47650131-47650153 GTGGGAAGGGAGGGTGGGGTGGG - Exonic
1148554384 17:48569496-48569518 CTAGGGGGTGGGGGTGGGGTGGG + Intronic
1148657474 17:49298556-49298578 GTGGGTGGTGAGGGTGTGGGTGG + Exonic
1148767596 17:50048210-50048232 ATGGGGGTTGGCGTTGGGGTGGG + Intergenic
1148780401 17:50118104-50118126 GTGGGAGGAGAGGGAGGGGTGGG + Intronic
1148807096 17:50269393-50269415 GTGGGGGGTGGGGGTCAGGTGGG + Intergenic
1148876339 17:50689706-50689728 GTGGGGGGTGAGGGTAGGAGAGG - Intronic
1148985029 17:51613485-51613507 GAGGGGGGTGAGGGAGGGGGAGG - Intergenic
1149127912 17:53257749-53257771 GGGGTGGGTGATGGCGGGGTAGG - Intergenic
1149345833 17:55734431-55734453 GTGGGGGTTGATGGTGGTGAAGG - Intergenic
1149485975 17:57043215-57043237 GGGAGGGGTGACAGTGGGGTGGG - Intergenic
1149499612 17:57142188-57142210 CTGGGTTGTGACTGTGGGGTGGG - Intergenic
1149784096 17:59421135-59421157 GGGGTGGGTGGGGGTGGGGTCGG - Intergenic
1149849644 17:60027037-60027059 GTGTGGGGTGGGGGTGGGATGGG + Intergenic
1149860524 17:60119487-60119509 GTGTGGGGTGGGGGTGGGATGGG - Intergenic
1150376336 17:64684587-64684609 GCTGGGGGTGGAGGTGGGGTGGG + Intergenic
1150399248 17:64844015-64844037 GTGGGGGGTGGCGCTGAGGCGGG + Intergenic
1150405555 17:64897488-64897510 GTGGTGGGGTAGGGTGGGGTAGG + Exonic
1150449876 17:65257843-65257865 TTGGGGGGTGAGAGTGGGGATGG + Intergenic
1151217943 17:72590884-72590906 GTGGGGGCAGAGGGTGGGGAAGG + Intergenic
1151277401 17:73045968-73045990 GTGAGTGGTGATGCTGGGGTTGG - Intronic
1151418693 17:73983620-73983642 GTGGGGGGTGGTGGTGGGGGTGG - Intergenic
1151534141 17:74729262-74729284 CTGGTGGGTGACAGTGGTGTGGG + Intronic
1151575830 17:74952198-74952220 GTGGGCGGGGCCGGTGGTGTGGG - Intronic
1151876539 17:76870344-76870366 GTGGGTGGTGATGGGGGCGTCGG + Intronic
1151939480 17:77283406-77283428 GAGGGGGCTGATGGTGGGGGTGG + Intronic
1152178262 17:78801956-78801978 GTGGGGGGTGAAGGTTGGTAGGG + Intronic
1152238380 17:79149964-79149986 ATGGGGGCTGAGGGTGGGGATGG + Intronic
1152266065 17:79295680-79295702 GGGGGAGCTGACGGTGGGGCAGG - Intronic
1152335667 17:79699214-79699236 GTTTGGGGTGCCAGTGGGGTGGG - Intergenic
1152440945 17:80309344-80309366 GTGGGGGGTGTCAGTGGGCCAGG + Intronic
1152537295 17:80958189-80958211 GTGGGGGGGGGGGGTGAGGTGGG - Intronic
1152650187 17:81488975-81488997 GTGGGAGGTGGCGGTGGCCTTGG - Intergenic
1152695085 17:81740160-81740182 GTGGGGGATGGGGGTGGGGGTGG + Intergenic
1152965696 18:112011-112033 GTGGGGGGTGGGGGTGGGGAGGG + Intergenic
1152965721 18:112061-112083 GCGGGGGGTGGGGGTGGGGAGGG + Intergenic
1153728411 18:7981173-7981195 GTAGAGAGTGAAGGTGGGGTTGG - Intronic
1154035617 18:10798966-10798988 GTTGGGTGTGAGGGTGGGGTGGG + Intronic
1154241416 18:12657425-12657447 ATGGGGGGGGACGGCGGGGGCGG + Intronic
1154326526 18:13395449-13395471 GTGGGGGCTGGCGTGGGGGTGGG + Intronic
1154344497 18:13530874-13530896 GTGTGGGCTGGGGGTGGGGTGGG + Intronic
1154413148 18:14153797-14153819 GTTGGGGGTGGAGGGGGGGTGGG - Intergenic
1154485077 18:14866672-14866694 TTGTGGGGTGGTGGTGGGGTGGG + Intergenic
1154940930 18:21111899-21111921 GTGGGGCGGGGCGGTGAGGTGGG + Intergenic
1155243502 18:23885336-23885358 GTGTGGGGTGGGGGTGGGGGTGG - Intronic
1155502772 18:26503842-26503864 GCTGGGGGTGGGGGTGGGGTGGG + Intronic
1155946789 18:31861938-31861960 GGGGGGGGGGGCGGTGGGGGAGG + Intronic
1157311610 18:46557229-46557251 GTGGAGGGTGAGGGTGGGCTGGG - Intronic
1157312050 18:46560049-46560071 GTGGGGGGTGGGGGTGGGGAGGG - Intronic
1157386440 18:47262669-47262691 GGGTGGGGTGGCGGTGGTGTGGG + Intergenic
1157589516 18:48827995-48828017 GTCGGGAGTGGAGGTGGGGTGGG - Intronic
1158067212 18:53425009-53425031 GAGGGGTGTGACTGTGGGATAGG + Intronic
1158470906 18:57735968-57735990 GTTGGGGGTGGGGGTGGGGGGGG - Intronic
1158507567 18:58060133-58060155 GTTGGGGGTGGGGTTGGGGTGGG + Intronic
1158801559 18:60916792-60916814 TCTGGGGGTGAGGGTGGGGTGGG + Intergenic
1158883468 18:61803650-61803672 GTTGGGGGTGGGGGTGGGGAAGG - Intergenic
1159339145 18:67112272-67112294 GTGGAGGGGGAGGGCGGGGTGGG - Intergenic
1159637279 18:70820692-70820714 GATGGGGGTGGCGGTGGGGAGGG + Intergenic
1160008742 18:75088246-75088268 GTGTGGGCTGAGGGTGGGCTGGG - Intergenic
1160332701 18:78010075-78010097 GTGGTGGGTGATGGTGGTGATGG + Intergenic
1160461701 18:79043531-79043553 GTGGGGGATGGGGTTGGGGTTGG - Intergenic
1160561891 18:79764169-79764191 GTGGGTGGTGACCGTGTGGCTGG + Intergenic
1160578942 18:79872923-79872945 GTGGGGAGGGTCTGTGGGGTGGG + Intronic
1160711909 19:556007-556029 GTGGGTGGGGTGGGTGGGGTGGG - Intergenic
1160823573 19:1069065-1069087 GTGTGGGGTGCCGCTGGTGTAGG + Intronic
1160904819 19:1447121-1447143 GAGGTGGGGGAGGGTGGGGTAGG - Intronic
1160959816 19:1715413-1715435 GCGGGGGGCGACGTCGGGGTTGG - Intergenic
1161077820 19:2294804-2294826 GTGGCGGGTGGAGGTGGGGTTGG + Intronic
1161091295 19:2361201-2361223 GTGGGAGGTGGGGCTGGGGTGGG + Intergenic
1161091309 19:2361232-2361254 GTGGGAGGTGGGGCTGGGGTAGG + Intergenic
1161091357 19:2361348-2361370 GTGGGAGGTGAGTCTGGGGTGGG + Intergenic
1161106282 19:2445520-2445542 GTGGGGGCCGCTGGTGGGGTGGG - Intronic
1161106303 19:2445589-2445611 GTGGGGGCCGCTGGTGGGGTGGG - Intronic
1161106324 19:2445658-2445680 GTGGGGGCCGCTGGTGGGGTAGG - Intronic
1161106344 19:2445727-2445749 GTGGGGGCCGCTGGTGGGGTGGG - Intronic
1161106364 19:2445796-2445818 GTGGGGGCCGCTGGTGGGGTGGG - Intronic
1161106382 19:2445865-2445887 GTGGGGGCGGCTGGTGGGGTGGG - Intronic
1161106424 19:2446002-2446024 GTGGGGGCAGCTGGTGGGGTGGG - Intronic
1161106444 19:2446071-2446093 GTGGGGGCGGCTGGTGGGGTGGG - Intronic
1161106485 19:2446207-2446229 GTGGGGGCCGCTGGTGGGGTGGG - Intronic
1161241743 19:3226824-3226846 GTGAGGGGTGAAGGAGGGGCTGG + Intronic
1161256778 19:3314179-3314201 GGGGGGGGGGTCGGTGGGGGGGG + Intergenic
1161266238 19:3366075-3366097 CTCGGGGGTGATGGGGGGGTGGG + Intronic
1161346773 19:3772147-3772169 GTGGGCGGTGAGTGCGGGGTGGG - Exonic
1161411800 19:4121866-4121888 CTAGGGGGTCACGATGGGGTGGG - Intronic
1161458436 19:4381662-4381684 GTGGGGGGTGACAGAGAGGCGGG - Intronic
1161770761 19:6229486-6229508 GTGGGGTATGCGGGTGGGGTGGG - Intronic
1161870076 19:6863192-6863214 GTGGGGGGGGCGGGTGGGGGTGG + Intergenic
1161990524 19:7681676-7681698 GTGGAGGGTGGGAGTGGGGTAGG - Intronic
1162136035 19:8555797-8555819 CTGGGGGGTGAGAGGGGGGTCGG + Intronic
1162408378 19:10489625-10489647 GTGGGTGGGGACGGTAGGGAGGG - Intronic
1163158185 19:15450052-15450074 GAGGGGGGGGGGGGTGGGGTGGG - Intergenic
1163167148 19:15506345-15506367 GTGGGGGGTAGAGGTGGGGGTGG - Intergenic
1163406613 19:17126909-17126931 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1163413674 19:17172659-17172681 GGAAGGGCTGACGGTGGGGTGGG - Intronic
1163441216 19:17323602-17323624 GTGGGCGGTAGCGGTGGGGGCGG + Exonic
1163567276 19:18059130-18059152 TAGGGGGGTGAGGGTGGGGTGGG + Exonic
1163726999 19:18928558-18928580 CTGGGGGGTGACCTTGGGTTGGG - Exonic
1164441210 19:28282123-28282145 GTGGGAGAAGACGGTGGGGTGGG - Intergenic
1165350597 19:35273048-35273070 GGCGGGGGTGAGAGTGGGGTGGG - Intronic
1165798949 19:38536126-38536148 ATGGCGGGTGGGGGTGGGGTGGG - Intronic
1165829688 19:38724293-38724315 TTGCGGGGTGACGGTGGTGTAGG - Exonic
1165883241 19:39058227-39058249 CCTGGGGGTGACGGTGGGGGAGG + Intergenic
1166219895 19:41357639-41357661 GTGGGGGGTCAGGGTGGGAGGGG - Intronic
1166734408 19:45075876-45075898 GCGGGTGGTGAGCGTGGGGTGGG + Intronic
1166746073 19:45142472-45142494 GTGACGGGTGTGGGTGGGGTGGG - Intronic
1166782707 19:45350799-45350821 GATGGGGGTGGGGGTGGGGTGGG - Exonic
1166836211 19:45669411-45669433 AGGCGGGGTGACGCTGGGGTTGG + Intronic
1166874812 19:45890861-45890883 CTGGGAGGTGGCGGTGGGGGTGG + Exonic
1167168285 19:47813953-47813975 GGGCGGGGTGGGGGTGGGGTGGG + Intronic
1167322628 19:48806049-48806071 GGGGGGGGAGATGGTGGGGGAGG - Intronic
1167397839 19:49243229-49243251 GGTGGGGGTGAGGGTGGGGAGGG + Intergenic
1167576379 19:50319955-50319977 GATGGGGGTGAGGATGGGGTCGG + Intronic
1167639027 19:50670179-50670201 GTGGGGAGGGACCGTGGGCTGGG - Intronic
1167650099 19:50724296-50724318 GGGCGGGGTGGCGGTGGGGGGGG - Intronic
1168350239 19:55671383-55671405 GTCGGGGGTGAGCGGGGGGTGGG + Intronic
1168400537 19:56083770-56083792 GTGGGGGTGGGGGGTGGGGTGGG + Intergenic
1168413459 19:56154581-56154603 GTTGGGGGTGGGGGTGGGGGTGG - Intronic
1168636821 19:58003009-58003031 GTGGGAGGCGACGGTGGAGGAGG - Exonic
1168722027 19:58559454-58559476 GTGGAGGGTTACAGTGGTGTAGG + Intergenic
1168728793 19:58607461-58607483 GTTAGGGGTGCCGTTGGGGTTGG + Intergenic
925361843 2:3285325-3285347 CTGGGGGGTGGGGGTGGGGGTGG - Intronic
925893990 2:8457323-8457345 GTTCGGGGTGGTGGTGGGGTGGG - Intergenic
926034915 2:9629057-9629079 TTGGGGGGTGGGGGTGGGGGAGG + Intronic
926104670 2:10142675-10142697 GCGGAGGGTGAAGGTGGGGTGGG - Intronic
926112152 2:10190277-10190299 GGTGGAGGTGATGGTGGGGTTGG + Intronic
926112216 2:10190631-10190653 GGTGGTGGTGATGGTGGGGTTGG + Intronic
926112239 2:10190781-10190803 GGTGGTGGTGATGGTGGGGTTGG + Intronic
926226069 2:10967706-10967728 GTGGGGGCTGAACGTGGGGATGG + Intergenic
926519017 2:13885742-13885764 TTGGGGGGTGAGGGTGGACTAGG - Intergenic
926711089 2:15881425-15881447 GTGGGGGGTGGCGGGGAGGGTGG + Intergenic
926846069 2:17140493-17140515 CTTGGGGGTGAAAGTGGGGTTGG - Intergenic
926915057 2:17883387-17883409 GTGGGGGGTTGGGGTGGGGTGGG + Intronic
927561454 2:24076827-24076849 GAGGGTGGTGGCGGTGGGGCGGG + Intronic
927639629 2:24838409-24838431 GTGGGTGGGGTGGGTGGGGTGGG + Intronic
927680298 2:25134616-25134638 GTGTGAGGTGGCGGCGGGGTCGG - Intronic
927917310 2:26945499-26945521 GCGGGGGGGGACGGGGGGGCGGG - Intronic
927929028 2:27032423-27032445 CTGAGGGGTGGGGGTGGGGTGGG + Intergenic
928032874 2:27796654-27796676 GGGAGGGGTGCCGGTGGGGAGGG + Intronic
928549719 2:32358035-32358057 GGGTGGGGTGGGGGTGGGGTGGG + Intronic
928588697 2:32790714-32790736 GGGTGGGGTGGAGGTGGGGTGGG - Intronic
928688334 2:33773306-33773328 GTGGGAGGTGGGGGTGGGGTAGG - Intergenic
929011225 2:37447263-37447285 GCGGGCGGTGGCGGGGGGGTGGG + Intergenic
929147805 2:38722032-38722054 GTGGGGGGGGGGGGTGGGGGGGG - Intronic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
929795384 2:45055033-45055055 GTGGGGGGCGGCGGTGAGCTGGG + Intergenic
929955378 2:46454263-46454285 GGGGGTGGTGACGGAGGGGCAGG - Intronic
930108603 2:47658964-47658986 GGAGGGGGAGACGGTGGAGTTGG - Intergenic
930842648 2:55864655-55864677 GTGGGGGATGAGGGTGGGGAGGG + Intergenic
930899196 2:56482882-56482904 TTGGGAGGTGCTGGTGGGGTAGG + Intergenic
931716491 2:65032931-65032953 ATGGGGGGTGGGGGTGGGGGTGG + Intergenic
931867178 2:66425935-66425957 GTGAGGGGTGACGCTGGGAGAGG - Intergenic
931980617 2:67690070-67690092 GTGTGGGGTGGGGGTGGTGTGGG + Intergenic
932655427 2:73607480-73607502 GATGGGGGTGAGGGTGAGGTGGG - Intronic
933317634 2:80734713-80734735 TTGGGGGGAGAAGGTGGGGATGG + Intergenic
934033232 2:88066443-88066465 GGTGGGGGTGACGGCGGGGGTGG - Intergenic
934492952 2:94774701-94774723 GTGGGGGGTGGGGGTGGTGGGGG - Intergenic
934542734 2:95189456-95189478 GTGAGGGGTGAGGGTGGGAGAGG + Intergenic
934555441 2:95284802-95284824 GTTGGGGGTGAAGGTGGGCCTGG - Intronic
934574348 2:95390907-95390929 GGCGGGGGTGTGGGTGGGGTGGG - Intergenic
935360933 2:102245694-102245716 GTGCGGGGTGAAGGGAGGGTCGG + Intergenic
935744574 2:106179243-106179265 GCGGGGGTTCAGGGTGGGGTGGG - Intronic
935745024 2:106182813-106182835 CTGGTGGGTGGGGGTGGGGTGGG + Intronic
936444722 2:112586547-112586569 GTGGAGGGTGAGGGTGGTGGTGG - Intronic
936618971 2:114075378-114075400 GGTGGGGGTGGGGGTGGGGTGGG + Intergenic
937061756 2:118985307-118985329 GTGGGAGGTGTGGCTGGGGTGGG - Intronic
937288517 2:120767950-120767972 GTGGGGGGTGAGGGTGGCAGTGG - Intronic
937376384 2:121338562-121338584 CTAGGGGGCGACGGTGGGCTCGG + Exonic
937922154 2:127138239-127138261 GTGGGGGGTGGAGGTGGGGGTGG - Intergenic
937925118 2:127162258-127162280 GTGGGTGCTGAGGGTGAGGTGGG - Intergenic
937967487 2:127525131-127525153 ATGGGGGGTGGGGGTGGTGTTGG + Intronic
937993229 2:127675348-127675370 GGTGGGGCTGACGGTGGGGTTGG + Intronic
938081647 2:128373444-128373466 GTGTGGGGTGGGGGTGGGGTGGG - Intergenic
938263171 2:129909566-129909588 GTGGGGGTGGACAGTGGGGAGGG - Intergenic
938435582 2:131281466-131281488 GTAGGGGGTGGAGGTGGGTTGGG + Intronic
938673878 2:133611242-133611264 GTGGAGGTTGAGGGTGGGGGTGG - Intergenic
938909637 2:135874995-135875017 GTGGTGGGTGACGGTGGCTGAGG + Intronic
939064702 2:137468628-137468650 GTGGGGGGTGGGGGTGGGGGCGG + Intronic
939175291 2:138740938-138740960 GTGGGGGCTGGGGGTGGGGTGGG + Intronic
939586778 2:144015447-144015469 GTGGTGGGTGAGGGGAGGGTGGG - Intronic
939914512 2:148021802-148021824 GGGGGGGGTGAAGGAGGGGTTGG + Intronic
940398679 2:153222313-153222335 GGGGGGGGGGGGGGTGGGGTGGG + Intergenic
940445237 2:153770159-153770181 GTGTGGGGGGGCGGGGGGGTGGG - Intergenic
940653089 2:156456780-156456802 GGGGAGGGTGAAGGTGGGTTGGG + Intronic
940687706 2:156874816-156874838 CTGGGGGGTGGGGGTGGGGGTGG - Intergenic
940982955 2:160023887-160023909 GTTGGGGGAGATGGTGGGGGTGG - Intronic
941076393 2:161010604-161010626 GTGGGGGGTGAGGGGGGTGGGGG + Intergenic
941580886 2:167293931-167293953 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
941808511 2:169733780-169733802 GTGGGGGGCGCCGCTGGGGAGGG + Intronic
941844528 2:170119972-170119994 GTGGTGGGTAATGGTGGAGTGGG - Intergenic
941869343 2:170367262-170367284 GGGGAGGGTGACGGATGGGTGGG + Intronic
941891809 2:170590430-170590452 TAGGGGTGTGAGGGTGGGGTGGG - Intronic
942277105 2:174331246-174331268 GGGTGGGGTGAGGTTGGGGTGGG - Intergenic
942457405 2:176147766-176147788 GTGGAGGGTGGGGGTGGGGTGGG - Intergenic
942534017 2:176944108-176944130 GTGGAGGGTGATGGATGGGTAGG - Intergenic
942589984 2:177533378-177533400 GGGTGGGGGGATGGTGGGGTGGG - Intronic
942638777 2:178038286-178038308 GAGGTGGGGGATGGTGGGGTGGG - Intronic
942695510 2:178638706-178638728 GGGGGCGGTGGTGGTGGGGTGGG - Intronic
942813789 2:180027640-180027662 GAGGGGGGTGATGATGGGGATGG - Intergenic
942851640 2:180494657-180494679 GTGGGGGTTGCTGGAGGGGTGGG - Intergenic
942970389 2:181951088-181951110 ATGGAGGCTGAAGGTGGGGTGGG - Intergenic
943090965 2:183374521-183374543 GGGGGGGGTGGGGGTGGGGATGG + Intergenic
943282216 2:185950038-185950060 GTTGGGGGTGATGGAGGGATTGG - Intergenic
943881465 2:193150104-193150126 GTGGTGGGTGATGCTGGGCTGGG + Intergenic
944490766 2:200255575-200255597 ATGGGGGGTGAAGGCAGGGTAGG + Intergenic
944506796 2:200420878-200420900 GTGTGTGTTGGCGGTGGGGTTGG - Intronic
944599651 2:201290372-201290394 GTGGTGGGGTAGGGTGGGGTGGG + Intronic
945265217 2:207884127-207884149 TTGGGGGGTGGGGGTGGGGACGG - Intronic
945696050 2:213105579-213105601 GTGGGGGGGGAAGGGGGGGGTGG + Intronic
946015406 2:216600234-216600256 GTGGGGAGTGATGGTGGAGGAGG - Intergenic
946322432 2:218961679-218961701 GTGGGGAGAGGCGGTGGGGGTGG - Exonic
946333289 2:219022216-219022238 GTGGGTGGTGGCAGCGGGGTTGG + Exonic
946502761 2:220267219-220267241 GTGGGTTGGGAGGGTGGGGTTGG + Intergenic
946812523 2:223541052-223541074 GTGGAGGGTGAAGGGGGAGTAGG - Intergenic
947217619 2:227763642-227763664 GGCGGGGGTGGGGGTGGGGTGGG + Intergenic
947653733 2:231808776-231808798 TTGGAGGGTGGGGGTGGGGTGGG + Exonic
947796378 2:232896540-232896562 GGTAGGGGTGAGGGTGGGGTAGG + Intronic
947796581 2:232897073-232897095 GTGAGGGGTGAGGGTTGGGATGG + Intronic
947910337 2:233796337-233796359 GTGGGCGGGGAGGGTGGGGTAGG + Intronic
948375860 2:237519812-237519834 CTGGGGGCTGAGTGTGGGGTTGG + Intronic
948588292 2:239034908-239034930 GTTGGGGGTGACGGAGGGGCAGG - Intergenic
948753448 2:240145237-240145259 GTGGGCAGTGAGGGTGGGGAGGG - Intergenic
948765391 2:240216676-240216698 GTGAGGGGTGGGGGTGGGGTGGG + Intergenic
949017037 2:241719360-241719382 GTGGGGGGTGTTGGGGGGTTGGG - Intronic
949022454 2:241749189-241749211 GTGGGAGGTGGTGGTGGTGTTGG - Intronic
1168771813 20:420695-420717 GTGGGGGATGGGGGTGGGGCTGG - Intronic
1168965733 20:1896776-1896798 CTGGGGGTGGAGGGTGGGGTGGG - Intronic
1169141375 20:3229066-3229088 AGGGTGGGTGAGGGTGGGGTGGG - Intronic
1169163356 20:3401844-3401866 GGAGGGGGTGACCGTGGGGAGGG + Intronic
1169954014 20:11081546-11081568 ATTGGGGGTGAAGGTGGGTTGGG + Intergenic
1171001355 20:21418934-21418956 GTGGGGTGGGAGGGTGGGGGAGG + Intergenic
1171004976 20:21455602-21455624 CTGGGGCCTGTCGGTGGGGTGGG - Intergenic
1171035689 20:21710682-21710704 CTGGGGAGTGGGGGTGGGGTGGG + Intronic
1171215494 20:23349635-23349657 GTGGGGGGAGAGGGTGCGGGGGG + Intergenic
1171291812 20:23986654-23986676 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1172129747 20:32647849-32647871 GTGGGTGGTGAGGCTGGGGAAGG - Intergenic
1172180340 20:32999699-32999721 GTGGAGGCTGGGGGTGGGGTAGG - Intronic
1172381039 20:34491995-34492017 CTGGGGGGTGGTGGTGGGATGGG + Intronic
1172891242 20:38266993-38267015 GTGGGGGGTGGGGGTGGGGGGGG + Intronic
1173578902 20:44132642-44132664 GTGGAGGGGGACGGTGGGGGTGG - Intronic
1173578915 20:44132680-44132702 GTGGAGGGGGACGGTGGGGGTGG - Intronic
1173578928 20:44132718-44132740 GTGGAGGGGGACGGTGGGGGTGG - Intronic
1173578941 20:44132756-44132778 GTGGAGGGGGACGGTGGGGGTGG - Intronic
1173579017 20:44132979-44133001 GTGGAGGGGGATGGTGGGGGTGG - Intronic
1173727373 20:45307165-45307187 ATGGGGCGCGGCGGTGGGGTAGG - Intronic
1173828489 20:46062763-46062785 GTGGGGGGTGCAGATGGAGTGGG + Exonic
1173886662 20:46465177-46465199 GGGGGTGGTGACTGTGGGATGGG + Intergenic
1173939018 20:46894562-46894584 GTGCGGGGTGTCGGTGGGTGGGG + Intergenic
1174351260 20:49970066-49970088 GAGGGGGTTGGGGGTGGGGTGGG - Intergenic
1174384561 20:50179443-50179465 GCGGGGCGTGGGGGTGGGGTGGG + Intergenic
1174717579 20:52776377-52776399 GTTGTGGGTGATGGTGGGTTGGG - Intergenic
1174747356 20:53076657-53076679 GTGGGAGGTGAGGGTGGAGCAGG + Intronic
1175173258 20:57094162-57094184 GTGGGGGGTGTCACTGAGGTGGG - Intergenic
1175193583 20:57227378-57227400 GTGGGGGGTGGGGGTGGGGATGG - Intronic
1175254044 20:57628150-57628172 GTGGGGGGTGAGGGTGAGAAGGG + Intergenic
1175389150 20:58615490-58615512 GTGGGTGGTGATAGTGGGGAGGG - Intergenic
1175522272 20:59609478-59609500 GGTGGGGGTGAGGGTGGGGGTGG - Intronic
1175669071 20:60885831-60885853 GTGGGGGGTGGTGGGGAGGTGGG + Intergenic
1175753356 20:61514304-61514326 GTGGGGGGGGGCGGGGGGGGCGG - Intronic
1175872799 20:62216451-62216473 CTCGGGGGTGGCGGTGGGGGCGG - Exonic
1175975506 20:62708642-62708664 GTGGGGGGTGGCGGCGGAGGAGG - Intergenic
1175988304 20:62775299-62775321 TTGGGAGGTGAGGATGGGGTTGG - Intergenic
1175990313 20:62785382-62785404 GAGGTGGGTGAGGGTAGGGTGGG + Intergenic
1176035402 20:63033890-63033912 GCTGGGGGTGGGGGTGGGGTGGG + Intergenic
1176084804 20:63291015-63291037 GCGGGGGGTTCCTGTGGGGTTGG + Intergenic
1176245598 20:64095123-64095145 GTGGGGGGAGATGGTGTGGGGGG + Intronic
1176247771 20:64105524-64105546 GATGGGGGTGATGGTGGGGGTGG + Intergenic
1176247840 20:64105692-64105714 GGTGGGGGTGATGGTGGGGGTGG + Intergenic
1176551392 21:8224014-8224036 GCGGGACGTGACGGGGGGGTGGG - Intergenic
1176553162 21:8238823-8238845 GGGAGGGGTGGGGGTGGGGTGGG + Intergenic
1176570301 21:8407013-8407035 GCGGGACGTGACGGGGGGGTGGG - Intergenic
1176572084 21:8421847-8421869 GGGAGGGGTGGGGGTGGGGTGGG + Intergenic
1176578210 21:8451200-8451222 GCGGGACGTGACGGGGGGGTGGG - Intergenic
1176579993 21:8466430-8466452 GGGAGGGGTGGGGGTGGGGTGGG + Intergenic
1176703758 21:10093225-10093247 GTTGGGGGTGGCAGGGGGGTTGG + Intergenic
1177636567 21:23795089-23795111 TTGGGGGGTGGGGGTGGGGGAGG - Intergenic
1178067419 21:28921082-28921104 GTGGGGGTTGGAGGTGGGGATGG - Intergenic
1178708722 21:34895583-34895605 TAGGGAGGTGACGGTGGGGTGGG + Intronic
1178763923 21:35431565-35431587 GTTGGTGGTGACAGTTGGGTTGG + Intronic
1178981247 21:37267211-37267233 GTGGGGGCTGGGGGTGGGGATGG - Intronic
1179033001 21:37736279-37736301 TCTGGGGGTGAGGGTGGGGTGGG + Intronic
1179586108 21:42375210-42375232 GTGGGGGGTCCCGGAGGGGGAGG - Intronic
1179645376 21:42772092-42772114 GTGGGGGCTGACAGGGGGGAAGG - Intronic
1179721093 21:43316389-43316411 GTGGAGGGTGTCGGGGGTGTCGG + Intergenic
1179729712 21:43360891-43360913 GCAGGGGGTGACGGTGGGCCTGG - Intergenic
1179881178 21:44293963-44293985 GTGGGTGGGGAGTGTGGGGTGGG - Intronic
1179951344 21:44710417-44710439 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1179960627 21:44765380-44765402 GCGTGGGGTGGCGGGGGGGTCGG - Intergenic
1180341365 22:11621573-11621595 GTGGGGGGGTGGGGTGGGGTGGG + Intergenic
1180481527 22:15760286-15760308 GCGCGGGGTGGGGGTGGGGTGGG + Intergenic
1180780729 22:18517940-18517962 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1181030266 22:20146128-20146150 GTGGGAGGCGACGGGGGGGCAGG + Intronic
1181100595 22:20536344-20536366 GTGGGAGGTGGGGGTGGGGGTGG + Intronic
1181199624 22:21209577-21209599 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1181371814 22:22424931-22424953 TTGGGGGGGTAGGGTGGGGTGGG + Intergenic
1181400136 22:22646281-22646303 GTGGGGAGGGAGGGTGGGGAGGG - Intronic
1181439218 22:22927229-22927251 GCGGGGGGTGGGGGTGGGGGTGG - Intergenic
1181639660 22:24189959-24189981 GTGCGGGGAGGCGGAGGGGTGGG - Intergenic
1181649228 22:24249509-24249531 GTGGGGAGGGAGGGTGGGGAGGG + Intergenic
1181662628 22:24363910-24363932 GTGGGCGGTGGGGGTGGGGGTGG + Intronic
1181702108 22:24627379-24627401 GTGGGGAGGGAGGGTGGGGAGGG - Intronic
1181755306 22:25020153-25020175 GTGAGGGGTAGAGGTGGGGTTGG - Intronic
1181874544 22:25929998-25930020 GTGAGGGGTGACAGGAGGGTAGG - Intronic
1182116757 22:27761142-27761164 ATTGGGGGTGGTGGTGGGGTGGG - Intronic
1182749055 22:32627134-32627156 GTGGGGGGTGGCAGTGCGGCGGG + Intronic
1183225393 22:36546478-36546500 GCGGGGGGTGAGGGGTGGGTTGG - Intergenic
1183306943 22:37087663-37087685 GTGGGGGGCACCGGTGTGGTTGG - Intronic
1183553291 22:38505935-38505957 GTGGAGGGTAAGGGTGGGGGAGG - Exonic
1183718722 22:39549784-39549806 GTGGGGAGTAAGGATGGGGTAGG - Intergenic
1183748017 22:39703594-39703616 GTGGGGGGTGTGGGTGTGGGGGG - Intergenic
1183829289 22:40409391-40409413 TTGGGGGATGGAGGTGGGGTGGG + Intronic
1184045399 22:41969724-41969746 GAGGGTGGTGGGGGTGGGGTGGG + Intergenic
1184101632 22:42344099-42344121 GTGGGGAGAGCCGGTGGAGTGGG - Intergenic
1184446321 22:44549269-44549291 GTGGGGAGTGAAGGTGGGGAAGG - Intergenic
1184453513 22:44596707-44596729 GTTGGGTGTGACGGTGGAGAAGG - Intergenic
1185336266 22:50272024-50272046 GTGTGGGGTGGGGGTGGGGGCGG + Intergenic
1203256415 22_KI270733v1_random:140958-140980 GCGGGACGTGACGGGGGGGTGGG - Intergenic
1203258160 22_KI270733v1_random:155865-155887 GGGAGGGGTGGGGGTGGGGTGGG + Intergenic
949358091 3:3202827-3202849 GTTGGGGGTGTGGGTAGGGTGGG - Intergenic
949623114 3:5838079-5838101 GCAGGGGGTGAGGATGGGGTGGG + Intergenic
949693550 3:6667859-6667881 GTGGGAGGTGGGTGTGGGGTGGG + Intergenic
950040454 3:9916313-9916335 GTGGGGGTTGGGGGTGGGGTGGG + Exonic
950119808 3:10474241-10474263 GTGGGTGGAGAAGGTTGGGTAGG + Intronic
950377018 3:12580445-12580467 GGGGGTGGTGGCGGGGGGGTAGG - Intronic
950380814 3:12613408-12613430 GTGGGGGGGGATGGCGGGGTGGG - Intronic
950694722 3:14690147-14690169 ATTGGTGGTGGCGGTGGGGTGGG + Intronic
950707058 3:14789422-14789444 GGGGAGGCTGACGGTGGGGGAGG - Intergenic
950797370 3:15521015-15521037 GTGGCAGGGGCCGGTGGGGTGGG - Intronic
950821878 3:15768652-15768674 GCGGGGGGCGGCGGTGGGGCAGG + Intronic
951458450 3:22920432-22920454 GTGGGGATTGAGGGTGGGGTGGG + Intergenic
952333930 3:32388921-32388943 GTGGGGAGTGAGGGTGGGGTTGG + Intergenic
952446857 3:33389473-33389495 GTGGGGGGTTAGGGTGGGGGTGG + Exonic
952449386 3:33417279-33417301 GTGGGGGGTGGGGGAGGGATGGG - Intronic
952974819 3:38684747-38684769 GTTGGGGGTGAGGGAGGGGTTGG + Intergenic
953331848 3:42060340-42060362 GTGGGGGGTGGTGGTGGGTGAGG + Intronic
953431775 3:42845985-42846007 GTGGAGGCTGAGGGTGGGGGTGG + Intronic
953472473 3:43178926-43178948 GTACGGGGTGACGGTGGTGGTGG - Intergenic
953574710 3:44103843-44103865 GTTGGGGGGGAGGGTGTGGTGGG - Intergenic
953677973 3:45018035-45018057 GTGAGGGTTGCGGGTGGGGTAGG + Intronic
953979734 3:47407606-47407628 GGCAGAGGTGACGGTGGGGTGGG + Intronic
953982036 3:47417938-47417960 GTGGGGGGAGAGGGTGGTGCGGG + Intronic
954223033 3:49166124-49166146 GCGCGGGGTGGGGGTGGGGTGGG + Intronic
954316913 3:49806282-49806304 GTGGGGGGTGGGGGGGAGGTGGG + Intronic
954418152 3:50404197-50404219 GTGGGGGGTGAAGGTGTGAGTGG + Intronic
954808382 3:53233115-53233137 GCGAGGGGTGAAGGTGGGGAGGG + Intronic
955503099 3:59604628-59604650 GGTGGGGGTGAGGGTGGGGAAGG - Intergenic
955596950 3:60601231-60601253 GTGGAGGGTGAGGGTGGAGAAGG - Intronic
956168145 3:66411941-66411963 GTGGCGGGGGAGGCTGGGGTGGG + Intronic
956322380 3:68011127-68011149 GTGGGGGGTGGTGGGGGGGTGGG + Intronic
956343141 3:68248742-68248764 GCGGGGGCTGGGGGTGGGGTAGG + Intronic
956699073 3:71942876-71942898 GTGGGCGGTGCGGTTGGGGTTGG - Intergenic
956871974 3:73427431-73427453 GTGGGCGGTGGTGGGGGGGTGGG - Intronic
957315440 3:78570233-78570255 GCAGGGGGTGAGGGTGGGGTGGG + Intergenic
959169378 3:102826032-102826054 TTGTGGGGTGGCGGGGGGGTGGG + Intergenic
960592762 3:119381390-119381412 GTGGGGGATGATGGTAGGGATGG - Intronic
960717941 3:120596131-120596153 GTGGGGAGCGGCGGTGGGGCAGG + Intergenic
960868569 3:122227306-122227328 GTGGGGGGTTGGGGTGGGGAGGG + Intronic
960973152 3:123153656-123153678 GTGGGGGGTGATGGGGGGTGGGG - Intronic
961356888 3:126344980-126345002 GTGGGAGGGGTAGGTGGGGTGGG - Intronic
961391085 3:126552711-126552733 GTGGGGGGTGAGCATGGAGTGGG + Intronic
961466687 3:127086015-127086037 GTGGGGGGTGGCGGTGGTTGGGG - Intergenic
962409560 3:135129199-135129221 ATGGGGGGTGGGGGTGGGGGAGG + Intronic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
962864654 3:139437788-139437810 GTGGGGGGTGAGGGTGGGGCTGG - Intergenic
963392303 3:144680878-144680900 GTGGGGTGGGAGGGTGGGGGAGG + Intergenic
964246470 3:154659714-154659736 GTGGGGGTGGGAGGTGGGGTTGG + Intergenic
964252724 3:154737747-154737769 GTGGGGGGCGGCGGCGGGGGTGG + Intergenic
965530920 3:169769257-169769279 GGGTGGGGTGGGGGTGGGGTAGG - Intronic
965590530 3:170357261-170357283 GGCGGCGGTGAGGGTGGGGTGGG + Intergenic
965747907 3:171944705-171944727 GTGGGAGGTTAAGGTGGGGAGGG + Intergenic
966318068 3:178671087-178671109 GTGGGGGGTGGTGGTGAGGGGGG - Intronic
966332139 3:178826194-178826216 GTGGAAGGTGAGGGAGGGGTTGG - Intronic
967126551 3:186429641-186429663 GTGGGGGGGGTCGGTGGGGTTGG - Intergenic
967126561 3:186429659-186429681 GTTGGGGGGGTCGGTGGGGTGGG - Intergenic
967126571 3:186429676-186429698 GTTGGGGGTGTCGGTGGGTTGGG - Intergenic
967158926 3:186718143-186718165 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967159018 3:186718392-186718414 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967987442 3:195106372-195106394 GTTGGGGGTGAGGGTTAGGTGGG - Intronic
968045909 3:195623879-195623901 GGGGCGGGTGGGGGTGGGGTTGG + Intergenic
968067686 3:195767844-195767866 GTTGGGGGTGATGGTGGCGATGG - Intronic
968090933 3:195897815-195897837 GCGGGGGGTGGGGGGGGGGTGGG - Intronic
968500150 4:946134-946156 GTGGGGGGTGACGGAGAAGGGGG - Intronic
968523026 4:1042868-1042890 GGGGTGTGTGTCGGTGGGGTGGG - Intergenic
968597848 4:1494615-1494637 CTGGGGGGTGATGGCGGGGAGGG - Intergenic
968628116 4:1637189-1637211 GTGGGGGGTGGGGGCGGGGATGG + Intronic
968648127 4:1749942-1749964 GGGGGCGGGGACCGTGGGGTGGG - Intergenic
968653189 4:1767930-1767952 GTGGGGGTGGAAGGCGGGGTGGG - Intergenic
968735776 4:2295923-2295945 GTGGATGGTGATGGTGGGGAAGG + Intronic
968761674 4:2445452-2445474 GTGGGGAGTGGGGGTGGGGTGGG - Intronic
968787370 4:2632681-2632703 GTGAGGGGTGGGGGTGGGGCAGG + Intronic
968812570 4:2806623-2806645 GAGGGTGGTGAGGGTGAGGTGGG - Intronic
969309656 4:6346039-6346061 GTGGGGCGTGACTCTGTGGTTGG - Intronic
969330199 4:6470485-6470507 GTTGGGGATGACGGTGGGATGGG - Intronic
969348289 4:6582793-6582815 GTGGGGGGTGAGGGGGTGGTGGG - Intronic
969642745 4:8408896-8408918 GGGGGGGGTGGGGGGGGGGTGGG + Intronic
969894501 4:10290835-10290857 GGGGGGGGTGGGGGTGGGGGTGG + Intergenic
971207228 4:24582834-24582856 GTGGGGCGTAATGGTGGGGGAGG + Intronic
971285090 4:25281298-25281320 GTAGGAGGTGAGGGTGGGCTAGG - Intergenic
971327907 4:25658912-25658934 GAGGGTGGTGGGGGTGGGGTGGG - Intronic
972479052 4:39480533-39480555 GTGGTGGATGACGAAGGGGTCGG - Intergenic
974858990 4:67496879-67496901 GGTGGGGGTGGGGGTGGGGTGGG - Intronic
974929816 4:68349623-68349645 GTGGGGGGTGGGGGTTGGGGAGG - Intronic
975187985 4:71425684-71425706 GTGGGGGTGGATGGTGGGGCAGG + Intronic
976139359 4:81974505-81974527 GTGTGTGGGGGCGGTGGGGTGGG - Intronic
976215428 4:82711272-82711294 GTAGGGGGTCACAGTGGGGAGGG - Intronic
976220756 4:82755114-82755136 ATGGGGGGTGAGGATGGGGGTGG + Intronic
976392131 4:84516705-84516727 GTGAGGAGTGAGGGTGGGCTGGG - Intergenic
976445804 4:85128938-85128960 GTCGGGGGTGGGGGTGGGATTGG - Intergenic
976447026 4:85141790-85141812 GTGGGGGGTGGGGGGGGGGGGGG - Intergenic
976601992 4:86946439-86946461 GTGGGGGGTGGGGGTGATGTAGG - Intronic
977222921 4:94358531-94358553 GTGTGGGGAGCTGGTGGGGTGGG + Intergenic
977598283 4:98908166-98908188 GGGTGGGGTGAAGGTGGGGAAGG - Intronic
977773171 4:100883501-100883523 TTGGTGGGTGACGATTGGGTGGG - Intergenic
978595504 4:110373280-110373302 GTGAGGGCTGACGGTGGCTTGGG + Intronic
979099586 4:116598714-116598736 CTGTGGGGTGACGGTGGTGTAGG - Intergenic
979195653 4:117917168-117917190 GGTGGTGGTGGCGGTGGGGTGGG - Intergenic
979638965 4:122989673-122989695 GTGGGGGCTGACCTTGGGCTGGG + Intronic
980130169 4:128810730-128810752 GAGGGGGGTGGGGGTGGGGGTGG + Intronic
980375974 4:131949577-131949599 GTTGGGGGTGGCAGGGGGGTTGG + Intergenic
981138171 4:141236629-141236651 GTAGGGGGTGAGGGAGGAGTTGG + Intergenic
981538171 4:145822327-145822349 GTGGAGGGTGGGGGTGGGGAAGG - Intronic
981937249 4:150250884-150250906 GTGGGGGGTGTGGGGGGTGTGGG - Intronic
981937362 4:150251194-150251216 GTGGGGGATGTGGGTGGTGTGGG - Intronic
981937472 4:150251510-150251532 GTGGGGGGTGTGGGGGGTGTGGG - Intronic
981937479 4:150251525-150251547 GTGGGGGGTGGGGGTGTGGGGGG - Intronic
982767717 4:159367417-159367439 GTGGGTGGTGATGGTGAGGGCGG - Intergenic
983553951 4:169043445-169043467 GTGGGGACAGAGGGTGGGGTGGG - Intergenic
983803859 4:171968833-171968855 GTGCGGGGTGGGGGGGGGGTTGG + Intronic
984587356 4:181579217-181579239 GTGGGCGGTCACAGTGGGGTGGG - Intergenic
985452568 4:190069558-190069580 GTGGGGGGTGGGGGTGGGGATGG - Intergenic
985453554 4:190072855-190072877 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985454544 4:190076148-190076170 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985455532 4:190079441-190079463 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985455929 4:190080812-190080834 GTGGGGGGGGGGGGTGGGGGGGG - Intergenic
985456516 4:190082735-190082757 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985457504 4:190086035-190086057 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985458491 4:190089328-190089350 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985459480 4:190092628-190092650 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985463731 4:190175397-190175419 GTGGGGGGTGGGGGTGGGGAGGG - Intronic
985521369 5:375392-375414 GTGGGGAGTGAGGGTGGTGGGGG + Intronic
985540884 5:486933-486955 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540902 5:487039-487061 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540908 5:487069-487091 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540920 5:487137-487159 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540932 5:487205-487227 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540944 5:487273-487295 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540956 5:487341-487363 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540968 5:487409-487431 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540980 5:487477-487499 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540989 5:487530-487552 GTGGTGGGTGTCAGTGCGGTGGG - Intronic
985540992 5:487545-487567 GTGGTGGGTGTCAGTGTGGTGGG - Intronic
985712789 5:1439315-1439337 GTGTGGGGTGGGGGTGGGGGTGG + Intronic
987374157 5:17218268-17218290 ATGGAGGGTGGGGGTGGGGTGGG + Intronic
987770308 5:22293841-22293863 GTTGGGGGTTAAGGTGGTGTTGG + Intronic
988472144 5:31549294-31549316 GTGGGAGGTGACTGTGGGGGTGG - Intronic
988613481 5:32750621-32750643 TTGTGGGGTGGAGGTGGGGTGGG + Intronic
988988119 5:36640842-36640864 GTGGTGGGTGTAGGTGGGGGTGG - Intronic
989379247 5:40797856-40797878 GGTGGGGGTGGGGGTGGGGTAGG - Intronic
989617571 5:43352256-43352278 GGGTGGGGTGGGGGTGGGGTGGG + Intergenic
990192832 5:53279832-53279854 GTGGGGGGTGGGGATGGGGGAGG - Intergenic
990311566 5:54544032-54544054 GGTGGGGGGGGCGGTGGGGTGGG + Intronic
990324500 5:54661488-54661510 GCCAGGGGTGAAGGTGGGGTGGG + Intergenic
990350229 5:54908748-54908770 GTGGGGGGTTTGGGTGGGGACGG - Intergenic
990674190 5:58164977-58164999 GCGGGGGCTGTCTGTGGGGTGGG + Intergenic
990700450 5:58469591-58469613 GTCGGGGGGGAAGGTGGGGATGG - Intergenic
990760832 5:59127611-59127633 GTGGGGGGTGAGGTGGGGGGTGG - Intronic
990909245 5:60837314-60837336 GTGGGGGGGGAGTGGGGGGTGGG + Intronic
991292299 5:65044804-65044826 GTGGGGGATGGCAGTGGGGATGG - Intergenic
991539852 5:67715517-67715539 CTGGGGGCTGTCGGTGGGGGCGG + Intergenic
991733474 5:69610830-69610852 GTTGGGGGTGTTGGTGGGGGGGG - Intergenic
991809908 5:70465976-70465998 GTTGGGGGTGTTGGTGGGGGGGG - Intergenic
991861480 5:71017020-71017042 GTTGGGGGTGTTGGTGGGGGGGG + Intronic
992315285 5:75546614-75546636 GTGGGGGTGGGGGGTGGGGTGGG - Intronic
992327015 5:75669659-75669681 GTGGTGGGGGCAGGTGGGGTGGG + Intronic
992430173 5:76703005-76703027 GTGGGGGGAGGGGGTGGGGGTGG + Intronic
992430207 5:76703146-76703168 GTGGGGGGAGGGGGTGGGGGGGG + Intronic
992614498 5:78535564-78535586 CTGGGGGCTGACGGTGAGGGAGG - Intronic
992651323 5:78863611-78863633 GTGGGGGGTGGGGGTAGGGATGG + Intronic
992726434 5:79612342-79612364 GTGGGGGGGGTGGGGGGGGTTGG + Intronic
993017514 5:82551720-82551742 GGGTGGGGTGGGGGTGGGGTGGG + Intergenic
993457378 5:88141752-88141774 GTGGGGGGTGGGGGCGGGGGCGG - Intergenic
993464639 5:88230072-88230094 GTCGGGGGAGAGGGTGAGGTGGG + Intronic
993502394 5:88678487-88678509 GATGGGGGTGAGGGCGGGGTGGG - Intergenic
994303135 5:98171083-98171105 GTCGGGGGTGGAGGTGGGGTAGG + Intergenic
994493265 5:100475644-100475666 GTGGGTGGTGATGGTGGTGAAGG + Intergenic
994525413 5:100900759-100900781 GTGGGGGGTGGGGGTGGGGTGGG + Intronic
995065703 5:107859546-107859568 TGGGGGGGTGGGGGTGGGGTGGG - Exonic
995151994 5:108859342-108859364 TTGGGGGGTGAGGCAGGGGTCGG - Intronic
995841578 5:116447418-116447440 GTTGGGGTTGACTCTGGGGTGGG + Exonic
996239005 5:121171303-121171325 GTGGAGGGTAAAGGTGGAGTTGG - Intergenic
996700466 5:126445626-126445648 GTGGGGGGTGAGGAGGGGGTGGG + Intronic
997201410 5:132011981-132012003 GGGGTGGGTGGCGGCGGGGTGGG - Intronic
997352236 5:133239219-133239241 GAGGGGGGTGGGGGTGGGGGAGG - Intronic
997426806 5:133808847-133808869 GTGGGGGGTGGCGGGGGGCGGGG - Intergenic
997428739 5:133822983-133823005 GTGGGGGCAGGAGGTGGGGTTGG + Intergenic
997625141 5:135326549-135326571 GTGGGGTGTGGTGGTGGGGGGGG - Intronic
997647044 5:135488783-135488805 GTGGTGGCTGTGGGTGGGGTTGG + Intergenic
997692602 5:135836962-135836984 GTGGGGGGGGGGGGTGGGGGGGG - Intronic
997878921 5:137572750-137572772 GTGGGGGTTGAGGGGTGGGTTGG - Intronic
998166808 5:139848752-139848774 GGGGGGGTTGGGGGTGGGGTAGG + Intronic
998401342 5:141850528-141850550 GGGGGGGGTGGGGGTGGGGGTGG + Intergenic
998843992 5:146287127-146287149 GTGGGGGGTGGAGGTGGGAGGGG + Exonic
999151734 5:149430756-149430778 TTGGGGGGCAACTGTGGGGTGGG - Intergenic
999277164 5:150339032-150339054 GTTGGGGGTGATGTTTGGGTGGG - Intronic
999393533 5:151212003-151212025 GTGGGTGGTGGTGGTGGGGGGGG + Intronic
999799498 5:155019794-155019816 GAGTGGGGTGGGGGTGGGGTGGG + Intergenic
1000298088 5:159929780-159929802 GTTGGGTGTGAATGTGGGGTAGG - Intronic
1000351827 5:160358341-160358363 GAGTGGGGTGAGGGTGGGGCAGG - Intronic
1000366054 5:160492343-160492365 GGTGGGGGTGGCGATGGGGTAGG - Intergenic
1001117917 5:168955090-168955112 GGGGGTGGTGGGGGTGGGGTGGG + Intronic
1001142124 5:169153235-169153257 GTAGCGGGTGGGGGTGGGGTGGG - Intronic
1001289967 5:170450116-170450138 GGGTGGGGTGAGGGTGGGGTGGG - Intronic
1001424561 5:171614903-171614925 GTGGTGGGTGGGAGTGGGGTGGG - Intergenic
1001489321 5:172144636-172144658 GTGGTGGGTGAGGCTGGGGGTGG - Intronic
1001535933 5:172497862-172497884 GAGGGGGGTGACAGGGGGCTGGG - Intergenic
1001548639 5:172586528-172586550 GTGGGGGCTGGGGATGGGGTGGG + Intergenic
1001731586 5:173964447-173964469 AGGGTGGGTGAGGGTGGGGTGGG + Intergenic
1001731595 5:173964469-173964491 GGTGAGGGTGACGGTGGGGTGGG + Intergenic
1001731623 5:173964530-173964552 GGGTGGGGTGAGGGTGGGGTGGG + Intergenic
1001731631 5:173964546-173964568 GGGTGGGGTGAGGGTGGGGTGGG + Intergenic
1001731660 5:173964606-173964628 GGGTGGGGTGAGGGTGGGGTGGG + Intergenic
1001959860 5:175873111-175873133 AAGGGGGGTGAGGGTGGGGGTGG - Intronic
1002082014 5:176743065-176743087 GTGTTGGGGGATGGTGGGGTTGG - Intergenic
1002195243 5:177497606-177497628 GTGGAGGGTGGCTGTGGGGGCGG - Intronic
1002345998 5:178547770-178547792 GTGGGGGGTGTGTGGGGGGTGGG - Intronic
1002355875 5:178627991-178628013 GTGGGGGGGGACGGCGGGCGGGG + Intronic
1002371180 5:178756064-178756086 GGTGGTGGTGATGGTGGGGTGGG + Intergenic
1002400503 5:178989203-178989225 GAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002418433 5:179132875-179132897 GTGGGCTGTGACGGTGTGATCGG - Exonic
1002566631 5:180115865-180115887 GTGGGGGGGGATTGTGGGGGTGG + Intronic
1002848747 6:972347-972369 GTGGCTGGTGAGGGCGGGGTGGG - Intergenic
1002898371 6:1391921-1391943 GTGGGAGGGGACGGTAGGGATGG + Intronic
1002904525 6:1438093-1438115 GGTGGGGGTGGGGGTGGGGTGGG - Intergenic
1003276827 6:4660789-4660811 GTGGGGCGTGCCCCTGGGGTGGG - Intergenic
1003302979 6:4901872-4901894 GTGGAGGCTGGGGGTGGGGTGGG - Intronic
1003660892 6:8060567-8060589 GTGAGGGCTGACGGTGAGCTGGG + Intronic
1004316618 6:14593642-14593664 GTGGGGAGTGTCAGTAGGGTAGG + Intergenic
1004905715 6:20235340-20235362 GTGGGGGGTGGGGGGGGGGACGG + Intergenic
1005281299 6:24277352-24277374 GAGTGGAGTGACGCTGGGGTGGG - Intronic
1006164712 6:32057479-32057501 GTGGGGGCTGAAGATGGGGATGG - Intronic
1006350957 6:33520990-33521012 GGGGGGGGTGGTGGTGGTGTCGG - Intergenic
1006428714 6:33982330-33982352 GTGGGGGGTGGTGGGGGAGTGGG - Intergenic
1006715922 6:36120513-36120535 GTGGGGGGTGGCGGTGGTGGTGG - Intergenic
1006834349 6:36987667-36987689 GTGGGGGGTGGGGGTAGGGGAGG + Intergenic
1006898315 6:37484474-37484496 GTGGTGGGTTGGGGTGGGGTGGG + Intronic
1006991122 6:38215894-38215916 GTGGGGGGCGCAGGTGGGGAGGG - Intronic
1007396109 6:41578705-41578727 GTGGGGGGTGGGCGGGGGGTGGG + Intronic
1007427753 6:41758101-41758123 GTGGGTGGTGACAGGTGGGTGGG + Intergenic
1007775450 6:44222254-44222276 GTGGGGGATGGGGGTGGGGTGGG + Intronic
1007938056 6:45751488-45751510 GTGGTGGGTGATAGAGGGGTAGG - Intergenic
1010846947 6:80720683-80720705 GGTGGGGGTGGCGGTGGGGGTGG - Intergenic
1011035455 6:82969224-82969246 GGTGGGGGTGGGGGTGGGGTGGG + Intronic
1012033443 6:94101627-94101649 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1012062348 6:94504801-94504823 GTGTGGGGGGAGGGTGGGGTTGG - Intergenic
1012381044 6:98619862-98619884 GTGGGGGTAGAGGGTGGGGATGG - Intergenic
1012398955 6:98828846-98828868 TTGGGGGGGGATGGGGGGGTGGG - Intergenic
1012602144 6:101111910-101111932 GTGGGAGGTGAGGGTTGGGAGGG + Intergenic
1012981547 6:105835635-105835657 GTTGAGGCTGACGGTGGGTTTGG - Intergenic
1013292651 6:108732489-108732511 GTCGGGGGTGGGGGTGGGGGGGG - Intergenic
1013746049 6:113347741-113347763 GTGGATGGTGAGGATGGGGTTGG - Intergenic
1013897991 6:115114897-115114919 GTGGGGTGTGGTGGTGGGGAGGG + Intergenic
1014889711 6:126828717-126828739 TTGGGGAGTGAGGGTGGGGAAGG - Intergenic
1015527017 6:134183845-134183867 GTGGGGGGTGGGGGTGGGGTGGG - Intronic
1016074406 6:139778704-139778726 GTGGGGGGTGGGGGTGGCATTGG + Intergenic
1016168263 6:140975028-140975050 CTGGGGCCTGTCGGTGGGGTGGG + Intergenic
1016890952 6:149006243-149006265 CTGGGGCGTGTCAGTGGGGTTGG - Intronic
1017041227 6:150310093-150310115 GGGGCGGGTGGAGGTGGGGTTGG - Intergenic
1017085387 6:150708384-150708406 GTGGGGAATGAAGGTGGGGCTGG - Intronic
1017385279 6:153875882-153875904 GTGAGGGGTGAGGGTGTGGAGGG - Intergenic
1017400067 6:154050610-154050632 GTGGGGGCTGATGGGGGGCTGGG + Intronic
1017631093 6:156397180-156397202 GTCGGGGGTGGGGGTGGGGGGGG - Intergenic
1017834839 6:158168093-158168115 GTGGGGGCGGACGGGGGCGTCGG - Intronic
1018030020 6:159834336-159834358 GTGGGGGGTGAGGGAGGGGTGGG - Intergenic
1018291726 6:162298605-162298627 GTGGGGGGTGGTGGGGGGGTGGG - Intronic
1018628708 6:165804737-165804759 GTGAGGGGTGAGCGCGGGGTCGG + Intronic
1018650140 6:165986277-165986299 GAGGAGAGTGAAGGTGGGGTTGG + Intronic
1018855103 6:167669353-167669375 GTTGGGGCTGACAGTGGGGTCGG + Intergenic
1018948974 6:168366018-168366040 CTGGTAGGTCACGGTGGGGTCGG - Intergenic
1019202845 6:170333151-170333173 GGGCGGGGGGGCGGTGGGGTGGG - Intronic
1019263152 7:93633-93655 CTGTGGGATGAGGGTGGGGTTGG - Intergenic
1019268701 7:133879-133901 GGTGGGGGTGAGGGTGGGGGTGG + Intergenic
1019321377 7:416967-416989 CTGGGTGGTGCCGGGGGGGTGGG + Intergenic
1019344041 7:521002-521024 GTTGGGGGTGACGGCTGGGCCGG - Intergenic
1019393368 7:802418-802440 GTGGGTGGGGAGGGTGGGGGAGG - Intergenic
1019405091 7:878962-878984 GGGGGGGGTGTCTGTGGGGCAGG - Intronic
1019507573 7:1400315-1400337 CTGGGGGGTGAGGGTTGAGTGGG - Intergenic
1019521916 7:1464748-1464770 GGGGGGGGGGAGGGCGGGGTGGG - Intergenic
1019627122 7:2022179-2022201 GTGTGGGGTGACGATGGTGCAGG + Intronic
1019786112 7:2978592-2978614 GAGGGAGGAGACGGTGGGGGTGG + Intronic
1019918381 7:4147968-4147990 GTGGGGCGGGACTGTGGGGCGGG - Intronic
1019929677 7:4215273-4215295 GTGGGTGGTGAAGGTGGAGGTGG + Intronic
1020011291 7:4807279-4807301 GTGGTGGGGGCCGGTGGTGTTGG - Intronic
1020069220 7:5214767-5214789 GAGGGGCATGCCGGTGGGGTGGG - Intronic
1020799828 7:12719762-12719784 GTGGGTGGTGGGGGTGGGGGTGG + Intergenic
1021489083 7:21198674-21198696 GTGGGGGGGGGCGGTGGTGAGGG + Intergenic
1021655173 7:22867639-22867661 GTGGGGTGGGACCATGGGGTTGG - Intergenic
1021705607 7:23364587-23364609 GTGGGGGGTGGCGGTGCAGTGGG + Intronic
1021709826 7:23404756-23404778 GTGGGGGGTGGGGGTGGGGATGG + Intronic
1021740646 7:23681837-23681859 GTGGGCTGGGAAGGTGGGGTGGG + Intronic
1021925209 7:25527939-25527961 GTGAGGGGTGAAGGCGGGCTTGG + Intergenic
1022020694 7:26397650-26397672 GGAGGGGGTGAGGGTGGGGGCGG + Intergenic
1022312340 7:29209015-29209037 CTGGGGGGTGGGGGTGGGGCAGG - Intronic
1022367361 7:29736344-29736366 GCGAGGGGTTAGGGTGGGGTGGG + Intergenic
1022524313 7:31027688-31027710 GGGCTGGGAGACGGTGGGGTGGG - Intergenic
1022528793 7:31054194-31054216 GTGTGGGGTGACGATGGAGGCGG + Intronic
1022747534 7:33188110-33188132 GTGGCGGGTGGGGGTGGGGTAGG + Intronic
1022928824 7:35087556-35087578 GCGAGGGGTTAGGGTGGGGTAGG - Intergenic
1022944306 7:35266637-35266659 GTGGGGGGGGGGGGCGGGGTGGG + Intergenic
1024295966 7:47842586-47842608 GTGGAGGATGAAGATGGGGTGGG - Intronic
1024611391 7:51067111-51067133 GTGTGGGGTGGCGTGGGGGTGGG + Intronic
1024971806 7:55078302-55078324 CTGGGCTGTGGCGGTGGGGTGGG - Intronic
1025855309 7:65271298-65271320 GTGGTGGGAGAAGATGGGGTGGG - Intergenic
1025882547 7:65554319-65554341 GTGGGGCGGGTCGGGGGGGTGGG - Intergenic
1025890896 7:65648284-65648306 GTGGGGCGGGTCGGGGGGGTGGG + Intronic
1026236919 7:68535096-68535118 GTGGTGGGTGGCGGGGTGGTGGG + Intergenic
1026247176 7:68631357-68631379 GTGGGGGCTGAGGGGGTGGTGGG - Intergenic
1026344848 7:69465178-69465200 GTGGGGGGGCGGGGTGGGGTCGG - Intergenic
1026579059 7:71598878-71598900 GTGGGTGGTGGGGGTGGTGTCGG + Intronic
1027237348 7:76305943-76305965 GTGGGGGGTGATATTGGGGGTGG - Intergenic
1027299963 7:76821837-76821859 GGTGGGGGTGAGGGTGGGGAGGG + Intergenic
1027318454 7:76998292-76998314 GTGGGAGGTGTGGGTGGAGTTGG + Intergenic
1027525663 7:79266233-79266255 GGTGGGGGTGGGGGTGGGGTGGG - Intronic
1028382350 7:90212820-90212842 GTTGGGGGTGGGGGTGGGGGTGG - Intronic
1028485557 7:91353650-91353672 GTAGGGAGTGGCGGCGGGGTGGG + Intergenic
1029169207 7:98618583-98618605 GGGGGGGGGGACGGAGGGGGAGG - Intronic
1029695829 7:102212651-102212673 GTGGGGTGTGGGGGTGGGGGTGG - Intronic
1031135110 7:117875504-117875526 GTGGGGGTTTGCGGTGGGGGGGG - Intergenic
1031660381 7:124416927-124416949 GTGGGGGGTGAGGGGCGGGGCGG - Intergenic
1031689181 7:124766214-124766236 GTGGGGGGTGGGGGTGGGAACGG + Intergenic
1031840954 7:126738691-126738713 GTGGGGGGTGAGTGGGGGGTTGG + Intronic
1032021328 7:128408561-128408583 GTGGGGGGTGCGGGTCGGTTGGG + Intronic
1032068904 7:128791860-128791882 GCGCGGGGCGAGGGTGGGGTGGG + Intronic
1032388631 7:131541357-131541379 GTTGGGGGTGACTTGGGGGTGGG + Intronic
1032462410 7:132122012-132122034 GTGTGGGGTGACTGTGGGAATGG - Intergenic
1032735837 7:134692072-134692094 GGGGCGGGAGGCGGTGGGGTGGG + Intergenic
1032876167 7:136040768-136040790 GTGTGGGGGGGCGGTGGGGTGGG + Intergenic
1032922599 7:136566713-136566735 GGGGGGGGGGAGGGTGGGGGCGG + Intergenic
1033098828 7:138453611-138453633 GTGGGGGGTGGGGGTGGGAGTGG - Intergenic
1033558033 7:142506144-142506166 GTGAGAGGTGAGGTTGGGGTGGG + Intergenic
1034071230 7:148187924-148187946 GTAGGGGGTGAAGTTGGGGCAGG - Intronic
1034560743 7:151877792-151877814 GGGTGGGGTGAGGGTGGGGGTGG - Intergenic
1034563001 7:151893797-151893819 GTGGGGGGTGACGCAGCGGGGGG - Intergenic
1034858405 7:154576106-154576128 GTGTGGGGTGATGGTAGGGGAGG - Intronic
1035230551 7:157463527-157463549 GTGAGGGGTGAGGATGGGGATGG - Intergenic
1035230652 7:157463815-157463837 GATGGGGGTGAGGATGGGGTGGG - Intergenic
1035230664 7:157463842-157463864 GATGGGGGTGAGGATGGGGTGGG - Intergenic
1035230694 7:157463931-157463953 GATGGGGGTGAGGATGGGGTGGG - Intergenic
1035520841 8:274007-274029 GTGGGAGTAGAGGGTGGGGTTGG + Intergenic
1035520866 8:274079-274101 GTGGGAGGTGTGGGTGGGGTTGG + Intergenic
1035713611 8:1737471-1737493 GTGGGAGGTGACTGTGTTGTGGG - Intergenic
1035724076 8:1813830-1813852 GTGGGGGGGGGCGGGGGGGAAGG - Intergenic
1035923234 8:3700980-3701002 GTGAGGGGCGACGGTGGTTTGGG + Intronic
1036560381 8:9896734-9896756 GTGGGTGGTGACTGTGGTGGAGG - Intergenic
1036589024 8:10151008-10151030 GTGGGCAGTGATGGGGGGGTGGG + Intronic
1036594708 8:10201168-10201190 GAGGAGGGTCACGGTGGGGCTGG - Intronic
1037121581 8:15294125-15294147 GTTGGGGGTGGGGGTGGGGGAGG + Intergenic
1037829130 8:22177807-22177829 GTGGGGGGAGAGGAGGGGGTGGG - Intronic
1037921627 8:22810421-22810443 GAGGGGGTTGGCGGTGGGGGAGG - Intronic
1038231719 8:25706749-25706771 GTGGGGGGTGGGGGTGGTGGGGG - Intergenic
1039453760 8:37695413-37695435 GTGGGGGGTGATGCTGGCGGGGG - Intergenic
1039921713 8:41897643-41897665 GTGCGGCGTGACGGGGTGGTTGG - Intergenic
1040593721 8:48818699-48818721 GTGGGGGGTGCAGGTTGGGGTGG + Intergenic
1041007276 8:53507928-53507950 GTGGGAGGTGGAGGTGGGGTGGG - Intergenic
1041007336 8:53508069-53508091 GTGGTGGGTGGTGGTGGGATGGG - Intergenic
1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG + Intergenic
1041276013 8:56157890-56157912 GTGGGGGCTGGGGGTGGGGGGGG + Intergenic
1041686114 8:60645973-60645995 ATTAGGGGTGATGGTGGGGTGGG + Intergenic
1042344125 8:67710400-67710422 GTGGGGGGTTGGGGGGGGGTGGG - Intronic
1042483897 8:69331253-69331275 GTGTGGGGTCAGGCTGGGGTGGG - Intergenic
1042859432 8:73297608-73297630 GTTAGGGGTGGCGGGGGGGTGGG - Intronic
1043874053 8:85464534-85464556 GTGGGGGTGGAAGGTGGGGGAGG - Intronic
1044945127 8:97382338-97382360 GTAGGGGGTGGGGGTGGGGGTGG - Intergenic
1045007463 8:97928693-97928715 GTGAGGGCTGATGGAGGGGTGGG + Intronic
1045271918 8:100669484-100669506 GGTGGGGGAGACTGTGGGGTGGG - Intergenic
1045703870 8:104897650-104897672 GTTGGGGGTGGGGGTGGGGGTGG + Intronic
1046813995 8:118564179-118564201 GCGGGGGGTGAGGGGGGGATGGG - Intronic
1047212830 8:122853775-122853797 GGGAGGGGTGACAGTGGGGTGGG - Intronic
1047362537 8:124182335-124182357 TTGGGGGGAGAGGGTGGGGTGGG + Intergenic
1047495032 8:125403259-125403281 GCGGGGGGCGGCAGTGGGGTGGG + Intergenic
1047863758 8:128998387-128998409 GTTGGGGGTTACAGTGGGGATGG + Intergenic
1047958839 8:129996262-129996284 GTGGGGTGTGAGGTGGGGGTTGG - Intronic
1047987284 8:130248210-130248232 GTGGCGGGTGCCGGGGGGGTTGG + Intronic
1048547143 8:135397652-135397674 GTGGGGGATGGAGGTTGGGTTGG - Intergenic
1049290065 8:141797151-141797173 GGTGGGGGTGCGGGTGGGGTTGG + Intergenic
1049443520 8:142619737-142619759 GGGGGGGGGGATGGTGGGGGTGG - Intergenic
1049583435 8:143422738-143422760 GTGGGGGTTGCAGGAGGGGTAGG - Intronic
1049643305 8:143725145-143725167 GAGGGGGGAGACGGGGGGGGGGG + Exonic
1049714253 8:144082495-144082517 GTGGGCGGTGCCGGTGAGGCCGG - Intergenic
1049882925 9:10415-10437 GTGGGGGTTGGGGTTGGGGTTGG - Intergenic
1050160250 9:2711381-2711403 GTGGGGGGGGGGGGTGGGGGGGG + Intergenic
1050851177 9:10288164-10288186 GGGGTGGGTGAGGGTGGGGATGG + Intronic
1051010785 9:12411213-12411235 GTGGGGGGTGTTGGGGGGGGCGG - Intergenic
1051249534 9:15145615-15145637 GGTGGGGGTGAGGGTGGGGGTGG - Intergenic
1052506874 9:29366505-29366527 GTGGGGTGGGAGGGTGGGGAGGG + Intergenic
1052807526 9:33025697-33025719 GTGGGGGGGGGGAGTGGGGTTGG + Intronic
1052878945 9:33588291-33588313 GTGGGGGGTGGGGGGGTGGTAGG + Intergenic
1052904165 9:33818364-33818386 TTGGGGGGTGGGGGTGGGGGTGG + Intronic
1052904169 9:33818370-33818392 GGTGGGGGTGGGGGTGGGGTGGG + Intronic
1053341393 9:37337380-37337402 GTGGGTGGGTAGGGTGGGGTGGG - Intronic
1053410634 9:37914263-37914285 GTGGTGGGTGGCGGTGGTGGCGG - Intronic
1053452154 9:38202310-38202332 GGTGGGGGTGGGGGTGGGGTGGG + Intergenic
1053513729 9:38711458-38711480 GTGGGGCCTGAAGGTGGGGTGGG - Intergenic
1054981248 9:71209365-71209387 GTGGGGGGAGAAGAGGGGGTAGG + Intronic
1055392144 9:75834422-75834444 GGTGGGGGTGGAGGTGGGGTTGG + Intergenic
1055479878 9:76699030-76699052 GGAGGGGGTGGGGGTGGGGTGGG - Intronic
1055522681 9:77097579-77097601 GGGTGGGGTGGGGGTGGGGTGGG - Intergenic
1055923726 9:81488895-81488917 GTAGGGGGTGGGGGTGGGGTGGG - Intergenic
1056278368 9:85015564-85015586 GTGGGGGATGAGGCAGGGGTTGG - Intronic
1056280805 9:85039656-85039678 CTGGGGGTTGGGGGTGGGGTGGG - Intergenic
1056305913 9:85289986-85290008 GTGGGGGGGGTGGGGGGGGTGGG + Intergenic
1056679157 9:88701942-88701964 GTGGGGGGAGACTGTGGTGGTGG + Intergenic
1056709606 9:88980079-88980101 GTGGGGGGTGGGGGTGGGGGTGG + Intergenic
1057195996 9:93115824-93115846 GGAGGGGGTGAGGGAGGGGTGGG + Intergenic
1057312598 9:93951575-93951597 GCAGGGGGTGAGGGTGGGGGTGG - Intergenic
1057365592 9:94417850-94417872 GGGGGGGGGGGGGGTGGGGTGGG - Intronic
1057370049 9:94463025-94463047 GTGTGGGGTGGGGGTGGGCTGGG - Intergenic
1057514031 9:95705762-95705784 GTGGGTGGTGATGGTGGTGGTGG - Intergenic
1057806471 9:98223260-98223282 GTGGGAGATGAGGGTGGGGATGG + Intronic
1058058769 9:100473984-100474006 GTGTGGGGAGGCGGTGGGGCCGG + Intronic
1058128719 9:101225729-101225751 GGTGGGGGTGGTGGTGGGGTGGG - Intronic
1058620641 9:106879330-106879352 GTGGGGGGTGGGGGGGGGGGTGG - Intronic
1059099293 9:111454299-111454321 GTGGGGGGAGATGGGGGGGTGGG + Intronic
1059450816 9:114370522-114370544 GTGGGGAGTGGCGGTGGGGGTGG + Intronic
1060556035 9:124507577-124507599 CTGGGGGCTGAGGGTGGGGGCGG + Intergenic
1060859749 9:126944583-126944605 GTGGGGAGGGAGGGTGGGATAGG + Intronic
1060882337 9:127126137-127126159 GTTGGGGGTAGGGGTGGGGTGGG - Intronic
1060919420 9:127409420-127409442 GTGGGGGGAGATGATGAGGTGGG + Intergenic
1060919433 9:127409452-127409474 GTGGGGGGAGCTGATGGGGTGGG + Intergenic
1060919463 9:127409530-127409552 GTGGGAGGTGATGGGGAGGTAGG + Intergenic
1060992059 9:127854809-127854831 ATGGGGGGAGGCAGTGGGGTGGG + Intergenic
1061192142 9:129088144-129088166 GTGGGGGGGGATGGGGGGATGGG + Intronic
1061218442 9:129235375-129235397 GTGGGGGGTGGGGGTGGTGACGG - Intergenic
1061231786 9:129319737-129319759 GTGGGGGTGCAGGGTGGGGTGGG + Intergenic
1061248189 9:129412149-129412171 GGTGGGGGTGGGGGTGGGGTGGG + Intergenic
1061310102 9:129756453-129756475 GTTGGGGGTGACGGTGATGGTGG + Intergenic
1061406420 9:130395109-130395131 GTAGGTGGTGGGGGTGGGGTGGG + Intronic
1061581189 9:131537448-131537470 GTAGGGGGTGGGGGTGGGGGTGG + Intergenic
1061854909 9:133436786-133436808 GAGGGGGATGGCGGTGGGGCGGG - Intronic
1061898321 9:133660053-133660075 GTGGGGGGTGAGGTGGGGGTGGG - Intergenic
1061987749 9:134139926-134139948 GTGGCGGATGACGAAGGGGTTGG - Exonic
1062265675 9:135685577-135685599 GGGTGGGGTGACCGGGGGGTAGG + Intergenic
1062361156 9:136188813-136188835 CTGGGGGGTGGGGGTGGGGGCGG + Intergenic
1062436186 9:136547555-136547577 CTGGTGGGTGGGGGTGGGGTGGG + Intergenic
1062498613 9:136842996-136843018 GAGGGGGGAGATGGGGGGGTGGG + Intronic
1062627405 9:137449540-137449562 CTGCGGGGCCACGGTGGGGTGGG - Intronic
1202780005 9_KI270717v1_random:24920-24942 GCGGCGGGTGGCGGGGGGGTAGG + Intergenic
1202788795 9_KI270719v1_random:63320-63342 GTTGGGGGTGGCAGGGGGGTTGG + Intergenic
1203787639 EBV:136744-136766 GAGGGGGGTGTGGGTGGGGGTGG - Intergenic
1203472571 Un_GL000220v1:122658-122680 GCGGGACGTGACGGGGGGGTGGG - Intergenic
1203474354 Un_GL000220v1:137888-137910 GGGAGGGGTGGGGGTGGGGTGGG + Intergenic
1185567975 X:1110109-1110131 GAGGGGGGTGATGGTGGCATAGG + Intergenic
1185981530 X:4785271-4785293 ATGGATGGTGATGGTGGGGTGGG - Intergenic
1186084534 X:5972753-5972775 GTGGGGGGCGGGGGCGGGGTGGG + Intronic
1186390612 X:9154956-9154978 ATGGGGGGTGGTGTTGGGGTTGG - Intronic
1186459953 X:9740049-9740071 GTGGGAGGAGAGGGTGGGGGAGG + Intronic
1186878748 X:13843094-13843116 TTGAGGGGTGAGGGTAGGGTAGG - Intronic
1186899338 X:14036934-14036956 GTGGGGGGTGATGGGGAGATGGG + Intergenic
1186913914 X:14199458-14199480 CTGGGGCCTGTCGGTGGGGTGGG + Intergenic
1187337485 X:18393844-18393866 GTGGGGGGTGGGAGGGGGGTGGG - Intergenic
1188052957 X:25509369-25509391 GTGGGGGGGAAATGTGGGGTGGG - Intergenic
1188711555 X:33406568-33406590 GTTGGGGGTGGCGGGGGAGTGGG + Intergenic
1189021957 X:37349984-37350006 GTGGCGGGTGACAGTGGGAGGGG + Intronic
1189288199 X:39866892-39866914 TTGGGGGGTGGGGGTGGGGGAGG - Intergenic
1189558153 X:42166238-42166260 GTGGGGGATGACTGTGGGCATGG + Intergenic
1189757051 X:44282636-44282658 GTGGGGGGGGGTGGGGGGGTGGG + Intronic
1189855819 X:45223903-45223925 GTGGGGGGTTGCGGGGAGGTTGG + Intergenic
1190123702 X:47684851-47684873 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1190542706 X:51495617-51495639 GTGGGGGGCGAGGGGTGGGTGGG - Intronic
1191714493 X:64185000-64185022 GTGGTGGGTGGAGGTGGAGTAGG - Intergenic
1191902843 X:66056647-66056669 GTGGGGGGTGAAGGAGGGATGGG + Intergenic
1191909648 X:66135322-66135344 CTGGGGCGTGTCGGGGGGGTGGG - Intergenic
1192169201 X:68844056-68844078 ATGGGGGGTGGAGGTGGGGAGGG - Intergenic
1192197283 X:69036905-69036927 GTGGGGGGTGGCTGTGGGATGGG + Intergenic
1192482919 X:71500530-71500552 GCGGGGGGTGGGGGCGGGGTGGG - Intronic
1192504664 X:71674133-71674155 GTGAGGGGTGAGGGAGAGGTGGG + Intergenic
1194786231 X:98087326-98087348 GTTGGGGGTGGTGGTGGGGTGGG + Intergenic
1194917636 X:99724073-99724095 GTGGGGGGTTGCTGTGGGCTTGG - Intergenic
1195065956 X:101238481-101238503 GTGGGAGGGGAGGGAGGGGTGGG + Intronic
1195174905 X:102305840-102305862 GTGGGGGGTGCCGGGGGTGCGGG + Intergenic
1195183960 X:102381253-102381275 GTGGGGGGTGCCGGGGGTGCGGG - Intronic
1195234400 X:102882516-102882538 GTGGGGGCTGGGGGTGGGGGAGG + Intergenic
1195705207 X:107733543-107733565 GAGGGGGATGAGGGTTGGGTGGG - Intronic
1195716245 X:107821145-107821167 GTGGGTGGGGATGATGGGGTGGG - Intergenic
1196029871 X:111085300-111085322 GCTGGAGGTGACAGTGGGGTTGG - Intronic
1196126014 X:112099586-112099608 GTGGGTGGGGAAGGTGTGGTAGG + Intergenic
1196522885 X:116694976-116694998 GTGGGGGGCGGGGGTGGGATGGG - Intergenic
1196697816 X:118632955-118632977 GTGGTGGGGGGCGGTGGGGGGGG + Intronic
1196751906 X:119125894-119125916 GTGGGGGGTGGGGGTGGGGTGGG + Intronic
1197195937 X:123700543-123700565 GTGGGGGGGGGTGGGGGGGTGGG + Intronic
1197720990 X:129744523-129744545 GTGAGGGGAAACGGTGGGATGGG - Intronic
1197785324 X:130192083-130192105 GTCTGGGGTGGGGGTGGGGTGGG + Intergenic
1197812857 X:130463537-130463559 CTGGGGGCTGAGGGTGGGGATGG - Intergenic
1197963667 X:132033107-132033129 GTGGGTGGTGGGGGTGGGATGGG + Intergenic
1198096007 X:133380343-133380365 TTGGGGGGTGGGGGTGGGGGTGG - Intronic
1198155223 X:133953271-133953293 GTAGGGGGTGGGGGTGGTGTGGG - Intronic
1198282535 X:135155902-135155924 GGTGGGGGTGCCGGGGGGGTGGG + Intergenic
1198288424 X:135216620-135216642 GGTGGGGGTGCCGGGGGGGTGGG - Intergenic
1198972119 X:142293445-142293467 GTGGGGGGGGGCCGGGGGGTTGG + Intergenic
1199106262 X:143872881-143872903 GTGGGGGAAGATGGTGGAGTAGG + Intergenic
1199238114 X:145513571-145513593 TTGGGGGGTGTGGGTGGGGGAGG - Intergenic
1199600116 X:149536820-149536842 GTGGGGGGGCAGGGTAGGGTAGG + Intergenic
1199628818 X:149762210-149762232 GAGGGGGGTGTCGGAGGGGACGG + Intergenic
1199650467 X:149943120-149943142 GTGGGGGGGCAGGGTAGGGTAGG - Intergenic
1199818174 X:151418832-151418854 GTGGGAGGTAGGGGTGGGGTAGG + Intergenic
1199833901 X:151569740-151569762 GTGAGGGCTGAGGGTGGGGTGGG + Intronic
1199834273 X:151573099-151573121 GTGGGGGCTGGGGGTGGGATTGG + Intronic
1199894787 X:152118754-152118776 GTGGGGGATGGAGGTGGGGATGG + Intergenic
1199949883 X:152699144-152699166 ATGGGGGATGGGGGTGGGGTTGG - Intronic
1199954712 X:152734173-152734195 TTGGGGGATGGGGGTGGGGTTGG - Intronic
1199959791 X:152769317-152769339 ATGGGGGATGGGGGTGGGGTTGG + Intronic
1200128702 X:153830034-153830056 GTGGGGTGGGAAGTTGGGGTTGG - Intronic
1201177269 Y:11316531-11316553 GTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1201179984 Y:11333941-11333963 GTGGTGGGTGGTGGTGGGGGTGG - Intergenic